Starting /dee2/code/volunteer_pipeline.sh SRR3207691 current disk space = 2823815847936 free memory = 1579472512 SRR3207691 SRAfilesize b4ba736e354eb11789373461e5f97af0 SRR3207691.sra SRR3207691.sra file validated SRR3207691 is single end SRR3207691 is conventional basespace SRR3207691 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207691_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1335 34.0 33.0 34.0 31.0 34.0 2 33.26525 34.0 34.0 34.0 31.0 34.0 3 33.32375 34.0 34.0 34.0 31.0 34.0 4 36.34225 37.0 37.0 37.0 35.0 37.0 5 36.45225 37.0 37.0 37.0 35.0 37.0 6 36.553 37.0 37.0 37.0 35.0 37.0 7 36.42125 37.0 37.0 37.0 35.0 37.0 8 36.5365 37.0 37.0 37.0 35.0 37.0 9 38.3645 39.0 39.0 39.0 37.0 39.0 10-11 38.357 39.0 39.0 39.0 37.0 39.0 12-13 38.389125 39.0 39.0 39.0 37.0 39.0 14-15 40.043 41.0 40.0 41.0 38.0 41.0 16-17 40.00812500000001 41.0 40.0 41.0 38.0 41.0 18-19 39.977625 41.0 40.0 41.0 38.0 41.0 20-21 39.882374999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.813125 41.0 40.0 41.0 38.0 41.0 24-25 39.79875 41.0 40.0 41.0 38.0 41.0 26-27 39.732749999999996 41.0 40.0 41.0 38.0 41.0 28-29 39.64075 41.0 40.0 41.0 37.5 41.0 30-31 39.339375000000004 41.0 40.0 41.0 36.5 41.0 32-33 39.485375 41.0 40.0 41.0 37.0 41.0 34-35 39.40925 41.0 39.5 41.0 37.0 41.0 36-37 39.363875 41.0 39.5 41.0 37.0 41.0 38-39 39.174499999999995 41.0 39.0 41.0 36.5 41.0 40-41 39.038375 40.5 39.0 41.0 35.5 41.0 42-43 39.0195 40.5 39.0 41.0 35.5 41.0 44-45 38.880875 40.5 39.0 41.0 35.5 41.0 46-47 38.98650000000001 41.0 39.0 41.0 35.5 41.0 48-49 38.8615 40.0 39.0 41.0 35.0 41.0 50-51 38.967749999999995 41.0 39.0 41.0 35.5 41.0 52-53 39.034875 41.0 39.0 41.0 35.0 41.0 54-55 38.986875 41.0 39.0 41.0 35.0 41.0 56-57 38.8795 41.0 39.0 41.0 35.0 41.0 58-59 38.617875 40.5 38.0 41.0 35.0 41.0 60-61 38.490375 40.0 38.0 41.0 35.0 41.0 62-63 38.160125 40.0 37.0 41.0 34.5 41.0 64-65 37.81575 39.0 36.5 41.0 34.0 41.0 66-67 37.48350000000001 39.0 36.0 41.0 34.0 41.0 68-69 37.08325 38.5 35.5 40.5 34.0 41.0 70-71 36.64575 37.0 35.0 40.0 33.0 41.0 72-73 36.305125000000004 37.0 35.0 39.0 33.0 41.0 74-75 35.84 36.5 35.0 39.0 33.0 40.5 76-77 34.814 35.5 34.0 37.0 31.5 39.0 78-79 34.960750000000004 36.0 35.0 37.0 32.0 39.0 80-81 34.687625 35.0 35.0 37.0 32.5 38.5 82-83 34.363 35.0 35.0 36.0 32.0 37.0 84-85 34.072625 35.0 35.0 36.0 32.0 37.0 86-87 33.852875 35.0 35.0 36.0 31.5 37.0 88-89 33.592375 35.0 34.0 35.0 31.0 36.0 90-91 33.439499999999995 35.0 34.0 35.0 31.0 36.0 92-93 33.373875 35.0 34.0 35.0 31.0 36.0 94-95 33.30175 35.0 34.0 35.0 31.0 36.0 96-97 33.186499999999995 35.0 34.0 35.0 31.0 35.5 98-99 33.067499999999995 35.0 34.0 35.0 31.0 35.0 100 32.914 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 2.0 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 4.0 13 3.0 14 6.0 15 1.0 16 0.0 17 7.0 18 2.0 19 5.0 20 4.0 21 4.0 22 2.0 23 6.0 24 10.0 25 7.0 26 14.0 27 16.0 28 16.0 29 29.0 30 26.0 31 34.0 32 62.0 33 55.0 34 98.0 35 157.0 36 304.0 37 793.0 38 1764.0 39 561.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.575 17.025000000000002 12.9 46.5 2 18.8 24.9 39.574999999999996 16.725 3 20.25 28.749999999999996 28.299999999999997 22.7 4 22.625 33.650000000000006 22.125 21.6 5 23.95 36.5 22.025 17.525 6 18.7 37.5 25.3 18.5 7 17.9 18.3 42.925000000000004 20.875 8 18.075 23.974999999999998 30.625000000000004 27.325 9 19.900000000000002 23.0 32.4 24.7 10-11 22.412499999999998 33.625 22.95 21.0125 12-13 20.3625 26.937499999999996 29.3875 23.3125 14-15 20.7625 28.675 28.6875 21.875 16-17 21.775 28.0875 27.737499999999997 22.400000000000002 18-19 22.287499999999998 28.6125 27.125 21.975 20-21 21.3875 29.2375 27.700000000000003 21.675 22-23 21.8125 28.812500000000004 27.3375 22.037499999999998 24-25 21.61621215911934 28.90918188641481 27.558168626469854 21.916437327995997 26-27 20.75 29.3875 27.800000000000004 22.0625 28-29 21.957936905358036 28.492739108662995 27.8292438657987 21.72008012018027 30-31 21.64328657314629 29.120741482965933 27.204408817635272 22.031563126252504 32-33 21.85 28.9875 27.425 21.7375 34-35 21.9625 27.987499999999997 27.787499999999998 22.2625 36-37 21.375 28.199999999999996 28.462500000000002 21.9625 38-39 22.15 28.6125 28.349999999999998 20.8875 40-41 21.6625 28.499999999999996 27.3625 22.475 42-43 21.9625 28.749999999999996 27.737499999999997 21.55 44-45 21.45 28.599999999999998 28.1875 21.762500000000003 46-47 22.375 28.1625 27.0625 22.400000000000002 48-49 21.875 28.025 28.1 22.0 50-51 22.1 28.525 27.8625 21.512500000000003 52-53 22.05 28.6875 27.537499999999998 21.725 54-55 21.7875 28.825 27.737499999999997 21.65 56-57 21.95 27.875 28.1 22.075 58-59 22.1875 28.3625 27.0125 22.4375 60-61 21.637500000000003 28.775000000000002 28.1625 21.425 62-63 21.762500000000003 28.000000000000004 28.15 22.0875 64-65 21.6625 28.8625 27.425 22.05 66-67 22.2125 27.975 27.800000000000004 22.0125 68-69 21.45 28.237499999999997 28.0875 22.225 70-71 21.837500000000002 28.675 27.9125 21.575 72-73 22.3875 28.9875 26.787499999999998 21.837500000000002 74-75 22.4625 28.425 27.800000000000004 21.3125 76-77 21.2375 27.575 28.849999999999998 22.3375 78-79 21.325 27.6875 27.987499999999997 23.0 80-81 22.425 28.812500000000004 27.825 20.9375 82-83 22.5125 28.762500000000003 27.2625 21.462500000000002 84-85 21.975 28.975 27.875 21.175 86-87 21.8875 28.15 28.275 21.6875 88-89 21.275 28.262500000000003 28.287499999999998 22.175 90-91 22.3625 28.6125 28.4125 20.6125 92-93 22.4625 28.012500000000003 27.8375 21.6875 94-95 22.2 27.975 28.225 21.6 96-97 21.875 28.7 28.1625 21.2625 98-99 21.987499999999997 29.2375 27.525 21.25 100 21.725 28.075 27.650000000000002 22.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.5 24 1.5 25 3.5 26 5.0 27 4.0 28 6.0 29 13.5 30 19.0 31 27.5 32 32.5 33 48.5 34 67.5 35 83.0 36 113.5 37 127.5 38 146.5 39 178.5 40 204.5 41 228.0 42 230.0 43 243.5 44 272.5 45 268.5 46 255.5 47 252.5 48 239.5 49 193.5 50 145.5 51 121.0 52 105.5 53 93.0 54 66.0 55 46.5 56 40.0 57 26.5 58 15.0 59 15.0 60 13.5 61 7.5 62 5.5 63 6.0 64 7.0 65 6.5 66 4.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.075 26-27 0.0 28-29 0.15 30-31 0.2 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728230 spots for SRR3207691.sra Written 728230 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra Read 728214 spots for SRR3207691.sra Written 728214 spots for SRR3207691.sra SRR ids: ['SRR3207691.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jsdby2jz SRR3207691.sra spots: 14564296 blocks: [[1, 728214], [728215, 1456428], [1456429, 2184642], [2184643, 2912856], [2912857, 3641070], [3641071, 4369284], [4369285, 5097498], [5097499, 5825712], [5825713, 6553926], [6553927, 7282140], [7282141, 8010354], [8010355, 8738568], [8738569, 9466782], [9466783, 10194996], [10194997, 10923210], [10923211, 11651424], [11651425, 12379638], [12379639, 13107852], [13107853, 13836066], [13836067, 14564296]] SRR3207691 file size 3779446 SRR3207691 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207691 SRR3207691_1.fastq Input file: SRR3207691_1.fastq trimmed: SRR3207691-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Apr 10 12:54:23 2025 >> started Thu Apr 10 12:54:31 2025 >> done (7.280s) 14564296 reads processed; of these: 2173 ( 0.01%) short reads filtered out after trimming by size control 13596 ( 0.09%) empty reads filtered out after trimming by size control 14548527 (99.89%) reads available; of these: 642159 ( 4.41%) trimmed reads available after processing 13906368 (95.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 291 0.00% 19 351 0.00% 20 414 0.00% 21 534 0.00% 22 702 0.00% 23 1042 0.01% 24 1474 0.01% 25 1891 0.01% 26 2642 0.02% 27 2342 0.02% 28 2035 0.01% 29 2049 0.01% 30 1942 0.01% 31 2048 0.01% 32 2088 0.01% 33 2196 0.02% 34 2254 0.02% 35 2517 0.02% 36 2570 0.02% 37 2542 0.02% 38 2662 0.02% 39 2559 0.02% 40 2720 0.02% 41 2854 0.02% 42 3051 0.02% 43 2990 0.02% 44 3129 0.02% 45 3186 0.02% 46 3303 0.02% 47 3496 0.02% 48 3451 0.02% 49 3604 0.02% 50 3618 0.02% 51 3983 0.03% 52 4108 0.03% 53 4414 0.03% 54 4943 0.03% 55 4107 0.03% 56 4448 0.03% 57 4451 0.03% 58 4526 0.03% 59 4561 0.03% 60 4714 0.03% 61 4779 0.03% 62 4986 0.03% 63 5076 0.03% 64 5124 0.04% 65 5410 0.04% 66 5644 0.04% 67 5738 0.04% 68 5972 0.04% 69 6078 0.04% 70 6258 0.04% 71 6521 0.04% 72 6700 0.05% 73 7035 0.05% 74 7212 0.05% 75 7392 0.05% 76 5284 0.04% 77 5872 0.04% 78 6628 0.05% 79 7174 0.05% 80 7791 0.05% 81 8310 0.06% 82 8796 0.06% 83 9606 0.07% 84 9859 0.07% 85 10476 0.07% 86 10892 0.07% 87 11794 0.08% 88 12829 0.09% 89 14272 0.10% 90 15489 0.11% 91 17370 0.12% 92 19011 0.13% 93 22251 0.15% 94 25690 0.18% 95 30319 0.21% 96 35500 0.24% 97 41800 0.29% 98 47618 0.33% 99 48801 0.34% 100 13906368 95.59% 14548527 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=8.75 fanout-score-rank=9 prefix-density=0.06 prefix-fanout=8.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=250.23 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.6 sequence=TTCTTCTTCTTTT Started job on | Apr 10 12:54:47 Started mapping on | Apr 10 12:54:47 Finished on | Apr 10 12:55:07 Mapping speed, Million of reads per hour | 2618.73 Number of input reads | 14548527 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13811960 Uniquely mapped reads % | 94.94% Average mapped length | 98.92 Number of splices: Total | 3979131 Number of splices: Annotated (sjdb) | 3908190 Number of splices: GT/AG | 3920552 Number of splices: GC/AG | 48150 Number of splices: AT/AC | 4240 Number of splices: Non-canonical | 6189 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311946 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 44080 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 424621 424621 424621 N_multimapping 311946 311946 311946 N_noFeature 571456 7117856 7161246 N_ambiguous 149969 22701 23135 UnstrandedReadsAssigned:13090535 PositiveStrandReadsAssigned:6671403 NegativeStrandReadsAssigned:6627579 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207691 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207691-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,548,527 reads, 13,396,942 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR3207691.ke.tsv 34699 SRR3207691.se.tsv 87100 total ==> SRR3207691.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 338 19.375 Potri.005G024800.1.v4.1 1035 936 58 6.81637 Potri.004G059700.1.v4.1 961 862 57 7.27392 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 209.204 8.09174 Potri.016G087400.1.v4.1 270 171 523 336.439 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 2.43135 Potri.012G127500.1.v4.1 977 878 1423 178.283 ==> SRR3207691.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1541 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207691 completed mapping pipeline successfully