Starting /dee2/code/volunteer_pipeline.sh SRR3207692 current disk space = 3059075448832 free memory = 1544085540 SRR3207692 SRAfilesize a1c42153cb7dd761bbe835a0e2390dbf SRR3207692.sra SRR3207692.sra file validated SRR3207692 is single end SRR3207692 is conventional basespace SRR3207692 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207692_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19475 34.0 33.0 34.0 31.0 34.0 2 33.3155 34.0 34.0 34.0 31.0 34.0 3 33.37675 34.0 34.0 34.0 31.0 34.0 4 36.4665 37.0 37.0 37.0 35.0 37.0 5 36.53075 37.0 37.0 37.0 35.0 37.0 6 36.50975 37.0 37.0 37.0 35.0 37.0 7 36.4765 37.0 37.0 37.0 35.0 37.0 8 36.531 37.0 37.0 37.0 35.0 37.0 9 38.42625 39.0 39.0 39.0 37.0 39.0 10-11 38.394499999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.384 39.0 39.0 39.0 37.0 39.0 14-15 40.064750000000004 41.0 40.0 41.0 38.0 41.0 16-17 40.068625 41.0 40.0 41.0 38.0 41.0 18-19 40.03825 41.0 40.0 41.0 38.0 41.0 20-21 39.934375 41.0 40.0 41.0 38.0 41.0 22-23 39.898875000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.879999999999995 41.0 40.0 41.0 38.0 41.0 26-27 39.807500000000005 41.0 40.0 41.0 38.0 41.0 28-29 39.7035 41.0 40.0 41.0 37.5 41.0 30-31 39.45675 41.0 40.0 41.0 37.0 41.0 32-33 39.568 41.0 40.0 41.0 37.0 41.0 34-35 39.476875 41.0 40.0 41.0 37.0 41.0 36-37 39.461 41.0 40.0 41.0 37.0 41.0 38-39 39.387125 41.0 39.5 41.0 37.0 41.0 40-41 39.1115 40.5 39.0 41.0 35.5 41.0 42-43 39.051874999999995 40.5 39.0 41.0 35.5 41.0 44-45 39.03375 40.5 39.0 41.0 35.5 41.0 46-47 39.052625 41.0 39.0 41.0 36.0 41.0 48-49 38.961 40.5 39.0 41.0 35.0 41.0 50-51 39.11225 41.0 39.0 41.0 36.0 41.0 52-53 39.181875 41.0 39.0 41.0 36.0 41.0 54-55 39.139125 41.0 39.0 41.0 35.5 41.0 56-57 38.958875 41.0 39.0 41.0 35.0 41.0 58-59 38.692 41.0 38.0 41.0 35.0 41.0 60-61 38.5575 40.0 38.0 41.0 35.0 41.0 62-63 38.208375000000004 40.0 37.0 41.0 34.5 41.0 64-65 37.916 39.0 37.0 41.0 34.0 41.0 66-67 37.601875 39.0 36.0 41.0 34.0 41.0 68-69 37.1325 38.5 35.5 40.5 33.5 41.0 70-71 36.69475 37.5 35.0 39.5 33.0 41.0 72-73 36.2685 37.0 35.0 39.0 33.0 41.0 74-75 35.88375 36.5 35.0 39.0 33.0 40.5 76-77 34.84075 35.5 34.5 37.0 31.0 39.0 78-79 34.964375000000004 35.5 35.0 37.0 32.0 39.0 80-81 34.702625 35.0 35.0 37.0 32.0 38.5 82-83 34.35825 35.0 35.0 36.0 32.0 37.0 84-85 34.12625 35.0 35.0 36.0 32.0 37.0 86-87 33.9405 35.0 35.0 36.0 32.0 36.5 88-89 33.614000000000004 35.0 34.0 35.0 31.0 36.0 90-91 33.47475 35.0 34.0 35.0 31.0 36.0 92-93 33.382875 35.0 34.0 35.0 31.0 36.0 94-95 33.2255 35.0 34.0 35.0 31.0 36.0 96-97 33.084 35.0 34.0 35.0 31.0 35.0 98-99 32.871624999999995 35.0 34.0 35.0 30.5 35.0 100 32.681 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 2.0 12 1.0 13 5.0 14 5.0 15 2.0 16 2.0 17 6.0 18 6.0 19 6.0 20 4.0 21 1.0 22 3.0 23 4.0 24 9.0 25 8.0 26 8.0 27 24.0 28 15.0 29 17.0 30 30.0 31 44.0 32 56.0 33 62.0 34 93.0 35 150.0 36 294.0 37 773.0 38 1836.0 39 531.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.775 15.950000000000001 13.125 45.15 2 20.674999999999997 23.125 37.974999999999994 18.224999999999998 3 20.05 27.650000000000002 27.85 24.45 4 23.65 33.575 20.75 22.025 5 23.474999999999998 34.5 23.125 18.9 6 19.05 35.4 26.125 19.425 7 17.474999999999998 19.15 43.225 20.150000000000002 8 18.25 24.925 29.7 27.125 9 19.325 22.825 33.25 24.6 10-11 22.662499999999998 32.475 23.275000000000002 21.587500000000002 12-13 20.1125 26.6 30.3 22.9875 14-15 20.674999999999997 27.6375 29.312500000000004 22.375 16-17 21.712500000000002 28.787499999999998 26.937499999999996 22.5625 18-19 21.462500000000002 28.5875 27.8625 22.0875 20-21 21.475 27.8625 28.1875 22.475 22-23 21.725 28.8625 27.650000000000002 21.762500000000003 24-25 22.19582343378767 28.210578967112664 26.84756783793923 22.746029761160436 26-27 22.237499999999997 28.175 27.825 21.762500000000003 28-29 21.188242651657283 28.242651657285805 28.055034396497813 22.5140712945591 30-31 20.580507944451394 28.524959339421997 28.612535968972853 22.28199674715376 32-33 22.025 27.787499999999998 28.1625 22.025 34-35 20.65 27.800000000000004 28.425 23.125 36-37 22.075 27.787499999999998 27.287499999999998 22.85 38-39 21.65 28.4125 27.187499999999996 22.75 40-41 22.075 28.462500000000002 27.8375 21.625 42-43 21.05 28.199999999999996 27.8375 22.912499999999998 44-45 22.275 28.425 27.3875 21.912499999999998 46-47 22.3125 28.3875 26.8375 22.4625 48-49 21.825 28.050000000000004 27.762500000000003 22.3625 50-51 21.975 28.575 26.924999999999997 22.525000000000002 52-53 21.9625 28.3875 27.375 22.275 54-55 21.224999999999998 27.712500000000002 29.1125 21.95 56-57 21.825 27.474999999999998 28.1875 22.5125 58-59 21.1375 28.575 27.987499999999997 22.3 60-61 21.7 28.962500000000002 28.050000000000004 21.2875 62-63 21.9625 27.05 28.65 22.3375 64-65 22.25 29.049999999999997 27.474999999999998 21.224999999999998 66-67 22.075 27.775 28.487499999999997 21.6625 68-69 21.4 28.725 28.487499999999997 21.3875 70-71 22.425 28.675 27.9375 20.962500000000002 72-73 22.3625 27.800000000000004 28.3375 21.5 74-75 21.375 27.500000000000004 28.199999999999996 22.925 76-77 22.325 27.625 27.5625 22.4875 78-79 21.6125 27.775 28.6875 21.925 80-81 22.3375 27.5625 28.125 21.975 82-83 21.987499999999997 28.225 28.0625 21.725 84-85 22.725 27.525 28.199999999999996 21.55 86-87 22.537499999999998 28.549999999999997 27.700000000000003 21.212500000000002 88-89 21.375 28.349999999999998 28.199999999999996 22.075 90-91 21.925 28.012500000000003 28.0625 22.0 92-93 22.6 27.6375 28.050000000000004 21.712500000000002 94-95 22.225 27.85 27.875 22.05 96-97 22.425 27.6625 27.9375 21.975 98-99 22.6125 28.175 28.425 20.7875 100 22.8 26.8 28.249999999999996 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 3.0 24 3.5 25 1.5 26 2.5 27 4.5 28 9.5 29 15.5 30 18.5 31 23.0 32 30.0 33 48.0 34 64.0 35 69.5 36 86.0 37 114.5 38 136.0 39 160.0 40 199.5 41 233.5 42 245.5 43 252.0 44 274.0 45 269.0 46 248.0 47 236.0 48 232.0 49 211.5 50 174.0 51 142.5 52 113.5 53 100.0 54 67.0 55 43.5 56 40.0 57 26.0 58 19.5 59 18.0 60 14.5 61 12.5 62 8.5 63 4.5 64 3.5 65 3.0 66 3.0 67 3.5 68 2.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.0625 30-31 0.08750000000000001 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79929754139488 99.45 2 0.15052684395383845 0.3 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATG 6 0.15 TruSeq Adapter, Index 7 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.16249999999999998 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525391 spots for SRR3207692.sra Written 525391 spots for SRR3207692.sra Read 525405 spots for SRR3207692.sra Written 525405 spots for SRR3207692.sra SRR ids: ['SRR3207692.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1q4szqhq SRR3207692.sra spots: 10507834 blocks: [[1, 525391], [525392, 1050782], [1050783, 1576173], [1576174, 2101564], [2101565, 2626955], [2626956, 3152346], [3152347, 3677737], [3677738, 4203128], [4203129, 4728519], [4728520, 5253910], [5253911, 5779301], [5779302, 6304692], [6304693, 6830083], [6830084, 7355474], [7355475, 7880865], [7880866, 8406256], [8406257, 8931647], [8931648, 9457038], [9457039, 9982429], [9982430, 10507834]] SRR3207692 file size 2723768 SRR3207692 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207692 SRR3207692_1.fastq Input file: SRR3207692_1.fastq trimmed: SRR3207692-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:58:07 2025 >> started Mon Feb 10 13:58:12 2025 >> done (5.120s) 10507834 reads processed; of these: 1522 ( 0.01%) short reads filtered out after trimming by size control 18261 ( 0.17%) empty reads filtered out after trimming by size control 10488051 (99.81%) reads available; of these: 454953 ( 4.34%) trimmed reads available after processing 10033098 (95.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 201 0.00% 19 207 0.00% 20 292 0.00% 21 388 0.00% 22 483 0.00% 23 668 0.01% 24 971 0.01% 25 1285 0.01% 26 1759 0.02% 27 1465 0.01% 28 1434 0.01% 29 1400 0.01% 30 1340 0.01% 31 1387 0.01% 32 1499 0.01% 33 1533 0.01% 34 1550 0.01% 35 1719 0.02% 36 1710 0.02% 37 1702 0.02% 38 1797 0.02% 39 1887 0.02% 40 1792 0.02% 41 1935 0.02% 42 2035 0.02% 43 2111 0.02% 44 2140 0.02% 45 2216 0.02% 46 2403 0.02% 47 2419 0.02% 48 2403 0.02% 49 2533 0.02% 50 2511 0.02% 51 2658 0.03% 52 2807 0.03% 53 3095 0.03% 54 3278 0.03% 55 2837 0.03% 56 2885 0.03% 57 3102 0.03% 58 2961 0.03% 59 3090 0.03% 60 3227 0.03% 61 3381 0.03% 62 3415 0.03% 63 3583 0.03% 64 3601 0.03% 65 3818 0.04% 66 3888 0.04% 67 3943 0.04% 68 4316 0.04% 69 4333 0.04% 70 4463 0.04% 71 4475 0.04% 72 4721 0.05% 73 4931 0.05% 74 5222 0.05% 75 5090 0.05% 76 3709 0.04% 77 4151 0.04% 78 4745 0.05% 79 5169 0.05% 80 5528 0.05% 81 6022 0.06% 82 6282 0.06% 83 6890 0.07% 84 7085 0.07% 85 7511 0.07% 86 7730 0.07% 87 8588 0.08% 88 9236 0.09% 89 10208 0.10% 90 11258 0.11% 91 12242 0.12% 92 13924 0.13% 93 15835 0.15% 94 18403 0.18% 95 21364 0.20% 96 25222 0.24% 97 29984 0.29% 98 34334 0.33% 99 35238 0.34% 100 10033098 95.66% 10488051 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=16 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=192.43 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=24.8 sequence=AAGAAGAAGAAA Started job on | Feb 10 13:58:30 Started mapping on | Feb 10 13:58:30 Finished on | Feb 10 13:58:43 Mapping speed, Million of reads per hour | 2904.38 Number of input reads | 10488051 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 9964423 Uniquely mapped reads % | 95.01% Average mapped length | 98.96 Number of splices: Total | 2859700 Number of splices: Annotated (sjdb) | 2808840 Number of splices: GT/AG | 2818416 Number of splices: GC/AG | 33854 Number of splices: AT/AC | 3115 Number of splices: Non-canonical | 4315 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224646 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 40380 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298982 298982 298982 N_multimapping 224646 224646 224646 N_noFeature 393753 5114788 5166962 N_ambiguous 109480 16330 16828 UnstrandedReadsAssigned:9461190 PositiveStrandReadsAssigned:4833305 NegativeStrandReadsAssigned:4780633 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207692 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207692-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,488,051 reads, 9,689,933 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR3207692.ke.tsv 34699 SRR3207692.se.tsv 87100 total ==> SRR3207692.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 292 22.8372 Potri.005G024800.1.v4.1 1035 936 63 10.1018 Potri.004G059700.1.v4.1 961 862 30 5.22335 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 150.218 7.92735 Potri.016G087400.1.v4.1 270 171 405 355.463 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 24 2.15174 Potri.012G127500.1.v4.1 977 878 872 149.059 ==> SRR3207692.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 999 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207692 completed mapping pipeline successfully