Starting /dee2/code/volunteer_pipeline.sh SRR3207693 current disk space = 3058939654144 free memory = 1580064036 SRR3207693 SRAfilesize 08fcdd907ef61d1159a37ad41db1a779 SRR3207693.sra SRR3207693.sra file validated SRR3207693 is single end SRR3207693 is conventional basespace SRR3207693 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207693_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15275 38.0 30.0 39.0 19.0 40.0 2 33.62975 37.0 31.0 40.0 23.0 40.0 3 33.59475 37.0 31.0 40.0 23.0 40.0 4 33.748 37.0 31.0 40.0 23.0 40.0 5 34.019 38.0 31.0 40.0 23.0 40.0 6 35.1115 38.0 33.0 40.0 27.0 40.0 7 35.217 38.0 33.0 40.0 27.0 40.0 8 35.0785 38.0 33.0 40.0 27.0 40.0 9 35.32875 38.0 33.0 40.0 27.0 40.0 10 35.3675 38.0 33.0 40.0 27.0 40.0 11 36.32 38.0 34.0 40.0 31.0 40.0 12 36.30525 38.0 34.0 40.0 31.0 40.0 13 36.335 38.0 34.0 40.0 31.0 40.0 14 36.33775 38.0 35.0 40.0 31.0 40.0 15 36.379 38.0 35.0 40.0 31.0 40.0 16 36.59625 39.0 35.0 40.0 31.0 40.0 17 36.51375 39.0 35.0 40.0 31.0 40.0 18 36.6595 39.0 35.0 40.0 31.0 40.0 19 36.64525 39.0 35.0 40.0 31.0 40.0 20 36.57075 39.0 35.0 40.0 31.0 40.0 21 36.70075 39.0 35.0 40.0 31.0 40.0 22 36.612 38.0 35.0 40.0 31.0 40.0 23 36.76025 39.0 35.0 40.0 31.0 40.0 24 36.70175 38.0 35.0 40.0 31.0 40.0 25 36.77925 39.0 35.0 40.0 31.0 40.0 26 36.7855 39.0 36.0 40.0 31.0 40.0 27 37.045 39.0 36.0 40.0 32.0 40.0 28 37.0475 39.0 36.0 40.0 31.0 40.0 29 36.98075 39.0 36.0 40.0 31.0 40.0 30 37.02225 39.0 36.0 40.0 31.0 40.0 31 37.19 39.0 36.0 40.0 32.0 40.0 32 37.17725 39.0 36.0 40.0 32.0 40.0 33 37.34825 39.0 37.0 40.0 33.0 40.0 34 37.30975 39.0 37.0 40.0 32.0 40.0 35 37.32375 39.0 37.0 40.0 32.0 40.0 36 37.41775 39.0 38.0 40.0 33.0 40.0 37 37.329 39.0 37.0 40.0 33.0 40.0 38 37.33925 39.0 38.0 40.0 33.0 40.0 39 37.3715 39.0 37.0 40.0 33.0 40.0 40 37.2355 39.0 37.0 40.0 32.0 40.0 41 37.21075 39.0 37.0 40.0 33.0 40.0 42 37.13725 39.0 37.0 40.0 32.0 40.0 43 37.19275 39.0 37.0 40.0 33.0 40.0 44 37.1405 39.0 37.0 40.0 32.0 40.0 45 37.047 39.0 37.0 40.0 31.0 40.0 46 37.112 39.0 37.0 40.0 32.0 40.0 47 37.12325 39.0 37.0 40.0 32.0 40.0 48 37.023 39.0 36.0 40.0 32.0 40.0 49 36.92775 39.0 36.0 40.0 31.0 40.0 50 36.9195 39.0 36.0 40.0 32.0 40.0 51 36.899 39.0 36.0 40.0 32.0 40.0 52 36.7085 39.0 36.0 40.0 31.0 40.0 53 36.59725 39.0 36.0 40.0 31.0 40.0 54 36.51425 39.0 36.0 40.0 31.0 40.0 55 36.462 39.0 36.0 40.0 31.0 40.0 56 36.42 39.0 36.0 40.0 31.0 40.0 57 36.35225 39.0 36.0 40.0 31.0 40.0 58 36.245 39.0 35.0 40.0 31.0 40.0 59 36.07975 39.0 35.0 40.0 31.0 40.0 60 36.12775 39.0 35.0 40.0 31.0 40.0 61 36.0155 39.0 35.0 40.0 31.0 40.0 62 35.73275 38.0 35.0 40.0 30.0 40.0 63 35.8015 38.0 35.0 40.0 30.0 40.0 64 35.5445 38.0 35.0 40.0 30.0 40.0 65 35.3775 38.0 35.0 40.0 29.0 40.0 66 35.26525 38.0 35.0 40.0 30.0 40.0 67 34.9495 38.0 35.0 39.0 29.0 40.0 68 33.583 36.0 33.0 39.0 25.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 0.0 4 0.0 5 0.0 6 3.0 7 0.0 8 0.0 9 0.0 10 0.0 11 4.0 12 4.0 13 0.0 14 2.0 15 2.0 16 6.0 17 6.0 18 4.0 19 6.0 20 5.0 21 7.0 22 9.0 23 22.0 24 16.0 25 21.0 26 24.0 27 41.0 28 64.0 29 73.0 30 55.0 31 82.0 32 96.0 33 120.0 34 166.0 35 274.0 36 444.0 37 654.0 38 735.0 39 1040.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.925907130170007 14.23496574473484 31.210352702359806 42.62877442273535 2 19.525000000000002 26.025 36.675000000000004 17.775 3 23.63090772693173 30.207551887971995 24.88122030507627 21.280320080020005 4 23.200000000000003 34.825 20.474999999999998 21.5 5 24.6 35.625 22.7 17.075000000000003 6 17.825 37.8 25.4 18.975 7 16.0 16.8 45.375 21.825 8 17.65 22.5 31.0 28.849999999999998 9 19.775000000000002 23.075000000000003 31.125000000000004 26.025 10 19.925 39.775 23.875 16.425 11 25.55 28.375 21.75 24.325 12 20.025000000000002 24.224999999999998 29.95 25.8 13 19.7 27.35 32.025 20.925 14 21.175 26.674999999999997 29.849999999999998 22.3 15 21.8 29.049999999999997 27.800000000000004 21.349999999999998 16 21.975 28.15 27.400000000000002 22.475 17 21.955488872218055 28.857214303575894 28.00700175043761 21.180295073768445 18 21.95 28.675 27.325 22.05 19 21.05 28.375 27.85 22.725 20 22.275 28.799999999999997 28.075 20.849999999999998 21 20.925 28.375 27.950000000000003 22.75 22 21.2 29.7 28.575 20.525 23 21.675 29.175 27.3 21.85 24 21.65 28.7 27.700000000000003 21.95 25 21.575 28.9 28.000000000000004 21.525 26 21.48037009252313 29.00725181295324 27.631907976994246 21.880470117529384 27 21.575 28.475 27.125 22.825 28 23.025000000000002 28.749999999999996 27.175 21.05 29 20.674999999999997 29.875 27.55 21.9 30 19.85 29.349999999999998 28.225 22.575 31 20.474999999999998 29.575000000000003 28.275 21.675 32 22.575 28.999999999999996 27.450000000000003 20.974999999999998 33 22.25 27.625 26.450000000000003 23.674999999999997 34 21.4 28.449999999999996 28.975 21.175 35 22.325 29.175 27.1 21.4 36 21.375 28.249999999999996 28.875 21.5 37 21.224999999999998 30.125 26.55 22.1 38 22.0 27.975 28.325 21.7 39 20.549999999999997 29.4 27.925 22.125 40 22.1 27.825 27.800000000000004 22.275 41 22.225 29.2 27.725 20.849999999999998 42 20.474999999999998 29.025000000000002 28.9 21.6 43 21.025 28.95 28.075 21.95 44 20.7 29.65 27.125 22.525000000000002 45 21.875 28.625 28.175 21.325 46 21.0 28.199999999999996 29.425 21.375 47 20.724999999999998 27.55 28.525 23.200000000000003 48 22.0 28.125 27.650000000000002 22.225 49 20.674999999999997 29.4 27.425 22.5 50 22.3 28.999999999999996 27.725 20.974999999999998 51 21.75 28.475 27.85 21.925 52 21.775 29.65 28.425 20.150000000000002 53 19.85 29.775000000000002 29.075 21.3 54 21.675 28.1 27.800000000000004 22.425 55 20.925 28.4 28.625 22.05 56 21.95 28.199999999999996 29.225 20.625 57 21.875 27.925 27.55 22.650000000000002 58 21.525 29.725 27.400000000000002 21.349999999999998 59 21.95 29.15 27.775 21.125 60 22.175 28.1 27.950000000000003 21.775 61 20.349999999999998 28.725 29.075 21.85 62 21.65 27.775 28.575 22.0 63 21.4 27.6 28.349999999999998 22.650000000000002 64 21.980495123780948 28.832208052013 28.507126781695426 20.68017004251063 65 21.575 29.425 28.599999999999998 20.4 66 22.875 28.025 28.325 20.775 67 21.4 28.475 28.549999999999997 21.575 68 23.175 27.750000000000004 28.075 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 5.0 22 6.0 23 5.0 24 13.0 25 22.0 26 22.0 27 24.5 28 27.0 29 42.0 30 65.0 31 73.0 32 80.5 33 102.0 34 116.0 35 135.0 36 183.5 37 213.0 38 226.0 39 269.0 40 310.0 41 321.0 42 336.0 43 348.5 44 346.0 45 340.0 46 328.5 47 323.0 48 302.5 49 249.5 50 217.0 51 181.0 52 123.0 53 101.0 54 94.0 55 71.5 56 56.0 57 48.0 58 29.5 59 19.0 60 16.0 61 11.5 62 10.0 63 8.0 64 4.5 65 4.5 66 6.0 67 5.5 68 4.0 69 3.0 70 2.0 71 1.0 72 1.0 73 1.5 74 1.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.025 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.025 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79914637208135 99.375 2 0.1506402209389907 0.3 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025106703489831784 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAA 10 0.25 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10 0.275 0.0 0.0 0.0 0.0 11 0.275 0.0 0.0 0.0 0.0 12 0.275 0.0 0.0 0.0 0.0 13 0.275 0.0 0.0 0.0 0.0 14 0.275 0.0 0.0 0.0 0.0 15 0.275 0.0 0.0 0.0 0.0 16 0.275 0.0 0.0 0.0 0.0 17 0.275 0.0 0.0 0.0 0.0 18 0.275 0.0 0.0 0.0 0.0 19 0.275 0.0 0.0 0.0 0.0 20 0.275 0.0 0.0 0.0 0.0 21 0.275 0.0 0.0 0.0 0.0 22 0.275 0.0 0.0 0.0 0.0 23 0.275 0.0 0.0 0.0 0.0 24 0.275 0.0 0.0 0.0 0.0 25 0.275 0.0 0.0 0.0 0.0 26 0.3 0.0 0.0 0.0 0.0 27 0.3 0.0 0.0 0.0 0.0 28 0.3 0.0 0.0 0.0 0.0 29 0.325 0.0 0.0 0.0 0.0 30 0.325 0.0 0.0 0.0 0.0 31 0.325 0.0 0.0 0.0 0.0 32 0.325 0.0 0.0 0.0 0.0 33 0.325 0.0 0.0 0.0 0.0 34 0.325 0.0 0.0 0.0 0.0 35 0.325 0.0 0.0 0.0 0.0 36 0.325 0.0 0.0 0.0 0.0 37 0.325 0.0 0.0 0.0 0.0 38 0.325 0.0 0.0 0.0 0.0 39 0.35 0.0 0.0 0.0 0.0 40 0.35 0.0 0.0 0.0 0.0 41 0.35 0.0 0.0 0.0 0.0 42 0.35 0.0 0.0 0.0 0.0 43 0.35 0.0 0.0 0.0 0.0 44 0.35 0.0 0.0 0.0 0.0 45 0.35 0.0 0.0 0.0 0.0 46 0.35 0.0 0.0 0.0 0.0 47 0.35 0.0 0.0 0.0 0.0 48 0.35 0.0 0.0 0.0 0.0 49 0.35 0.0 0.0 0.0 0.0 50 0.35 0.0 0.0 0.0 0.0 51 0.35 0.0 0.0 0.0 0.0 52 0.35 0.0 0.0 0.0 0.0 53 0.35 0.0 0.0 0.0 0.0 54 0.375 0.0 0.0 0.0 0.0 55 0.375 0.0 0.0 0.0 0.0 56 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260774 spots for SRR3207693.sra Written 260774 spots for SRR3207693.sra Read 260788 spots for SRR3207693.sra Written 260788 spots for SRR3207693.sra SRR ids: ['SRR3207693.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_otle6t2s SRR3207693.sra spots: 5215494 blocks: [[1, 260774], [260775, 521548], [521549, 782322], [782323, 1043096], [1043097, 1303870], [1303871, 1564644], [1564645, 1825418], [1825419, 2086192], [2086193, 2346966], [2346967, 2607740], [2607741, 2868514], [2868515, 3129288], [3129289, 3390062], [3390063, 3650836], [3650837, 3911610], [3911611, 4172384], [4172385, 4433158], [4433159, 4693932], [4693933, 4954706], [4954707, 5215494]] SRR3207693 file size 1089819 SRR3207693 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207693 SRR3207693_1.fastq Input file: SRR3207693_1.fastq trimmed: SRR3207693-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:16:09 2025 >> started Mon Feb 10 14:16:11 2025 >> done (2.532s) 5215494 reads processed; of these: 28067 ( 0.54%) short reads filtered out after trimming by size control 46332 ( 0.89%) empty reads filtered out after trimming by size control 5141095 (98.57%) reads available; of these: 332112 ( 6.46%) trimmed reads available after processing 4808983 (93.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1136 0.02% 19 2042 0.04% 20 4037 0.08% 21 980 0.02% 22 1290 0.03% 23 1835 0.04% 24 2853 0.06% 25 5948 0.12% 26 1631 0.03% 27 1517 0.03% 28 2011 0.04% 29 3134 0.06% 30 5660 0.11% 31 1456 0.03% 32 1924 0.04% 33 2101 0.04% 34 3211 0.06% 35 6146 0.12% 36 1510 0.03% 37 1932 0.04% 38 2791 0.05% 39 4624 0.09% 40 8948 0.17% 41 1877 0.04% 42 2361 0.05% 43 3364 0.07% 44 5803 0.11% 45 10881 0.21% 46 2313 0.04% 47 2890 0.06% 48 4344 0.08% 49 7126 0.14% 50 13475 0.26% 51 2986 0.06% 52 3919 0.08% 53 5514 0.11% 54 9456 0.18% 55 18216 0.35% 56 3868 0.08% 57 5136 0.10% 58 7640 0.15% 59 13233 0.26% 60 27352 0.53% 61 5380 0.10% 62 7134 0.14% 63 10880 0.21% 64 19535 0.38% 65 35864 0.70% 66 8345 0.16% 67 24503 0.48% 68 4808983 93.54% 5141095 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=119.17 fanout-score-rank=3 prefix-density=0.22 prefix-fanout=17.2 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=2 fanout-score=161.82 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.2 sequence=TTCTTCTTCTTT Started job on | Feb 10 14:16:24 Started mapping on | Feb 10 14:16:24 Finished on | Feb 10 14:16:30 Mapping speed, Million of reads per hour | 3084.66 Number of input reads | 5141095 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4838169 Uniquely mapped reads % | 94.11% Average mapped length | 66.90 Number of splices: Total | 886214 Number of splices: Annotated (sjdb) | 871296 Number of splices: GT/AG | 872467 Number of splices: GC/AG | 11233 Number of splices: AT/AC | 1076 Number of splices: Non-canonical | 1438 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164840 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 108791 % of reads mapped to too many loci | 2.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 138086 138086 138086 N_multimapping 164840 164840 164840 N_noFeature 256246 2530196 2534871 N_ambiguous 44812 7738 7778 UnstrandedReadsAssigned:4537111 PositiveStrandReadsAssigned:2300235 NegativeStrandReadsAssigned:2295520 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207693 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207693-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,141,095 reads, 4,730,309 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR3207693.ke.tsv 34699 SRR3207693.se.tsv 87100 total ==> SRR3207693.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 122 20.0283 Potri.005G024800.1.v4.1 1035 936 53 17.8385 Potri.004G059700.1.v4.1 961 862 12 4.38564 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 82.9156 9.18472 Potri.016G087400.1.v4.1 270 171 170 313.193 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 28 5.26941 Potri.012G127500.1.v4.1 977 878 1088 390.386 ==> SRR3207693.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 576 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 82 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207693 completed mapping pipeline successfully