Starting /dee2/code/volunteer_pipeline.sh SRR3207694 current disk space = 3059034947584 free memory = 1142121816 SRR3207694 SRAfilesize 6bd7ebae6b699b7f822e5beb2ba0986f SRR3207694.sra SRR3207694.sra file validated SRR3207694 is single end SRR3207694 is conventional basespace SRR3207694 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207694_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.112 34.0 33.0 34.0 31.0 34.0 2 32.742 34.0 34.0 34.0 31.0 34.0 3 33.322 34.0 34.0 34.0 31.0 34.0 4 36.66525 37.0 37.0 37.0 35.0 37.0 5 36.648 37.0 37.0 37.0 35.0 37.0 6 36.6595 37.0 37.0 37.0 35.0 37.0 7 36.57 37.0 37.0 37.0 35.0 37.0 8 36.599 37.0 37.0 37.0 35.0 37.0 9 38.58825 39.0 39.0 39.0 38.0 39.0 10-11 38.586375000000004 39.0 39.0 39.0 38.0 39.0 12-13 38.503 39.0 39.0 39.0 37.5 39.0 14-15 40.178625 41.0 40.0 41.0 38.0 41.0 16-17 40.179625 41.0 40.0 41.0 38.5 41.0 18-19 40.064499999999995 41.0 40.0 41.0 38.5 41.0 20-21 40.121375 41.0 40.0 41.0 38.5 41.0 22-23 40.079375 41.0 40.0 41.0 38.0 41.0 24-25 39.99325 41.0 40.0 41.0 38.0 41.0 26-27 39.9305 41.0 40.0 41.0 38.0 41.0 28-29 39.815250000000006 41.0 40.0 41.0 38.0 41.0 30-31 39.68425 41.0 40.0 41.0 38.0 41.0 32-33 39.71775 41.0 40.0 41.0 38.0 41.0 34-35 39.674125000000004 41.0 40.0 41.0 38.0 41.0 36-37 39.56975 41.0 40.0 41.0 37.5 41.0 38-39 39.546625 41.0 40.0 41.0 37.5 41.0 40-41 39.48425 41.0 40.0 41.0 37.0 41.0 42-43 39.590125 41.0 40.0 41.0 38.0 41.0 44-45 39.560249999999996 41.0 40.0 41.0 37.5 41.0 46-47 39.511375 41.0 40.0 41.0 37.0 41.0 48-49 39.410875000000004 41.0 40.0 41.0 37.0 41.0 50-51 39.249875 41.0 40.0 41.0 36.0 41.0 52-53 39.198125 41.0 39.0 41.0 36.0 41.0 54-55 38.966499999999996 41.0 39.0 41.0 35.0 41.0 56-57 38.795249999999996 41.0 39.0 41.0 35.0 41.0 58-59 38.541250000000005 40.5 38.0 41.0 35.0 41.0 60-61 38.403625000000005 40.0 38.0 41.0 35.0 41.0 62-63 38.105625 40.0 37.0 41.0 34.5 41.0 64-65 37.804375 39.5 36.5 41.0 34.0 41.0 66-67 37.505875 39.0 36.0 41.0 34.0 41.0 68-69 37.147000000000006 39.0 35.5 41.0 34.0 41.0 70-71 36.668875 37.5 35.0 40.0 33.5 41.0 72-73 36.16225 37.0 35.0 39.0 33.0 41.0 74-75 35.712875 36.5 35.0 39.0 33.0 40.5 76-77 34.837500000000006 35.5 34.5 37.0 31.5 39.0 78-79 34.834999999999994 35.5 35.0 37.0 31.5 39.0 80-81 34.60424999999999 35.0 35.0 37.0 32.0 39.0 82-83 34.40975 35.0 35.0 36.0 32.0 37.0 84-85 34.134375 35.0 35.0 36.0 32.0 37.0 86-87 33.798249999999996 35.0 35.0 36.0 32.0 37.0 88-89 33.67675 35.0 35.0 35.0 31.5 36.0 90-91 33.526875000000004 35.0 34.5 35.0 31.5 36.0 92-93 33.268 35.0 34.0 35.0 31.0 36.0 94-95 33.159125 35.0 34.0 35.0 31.0 36.0 96-97 33.016 35.0 34.0 35.0 31.0 35.0 98-99 32.868624999999994 35.0 34.0 35.0 30.5 35.0 100 32.83 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 3.0 11 2.0 12 1.0 13 6.0 14 1.0 15 3.0 16 3.0 17 10.0 18 3.0 19 3.0 20 7.0 21 6.0 22 6.0 23 5.0 24 4.0 25 10.0 26 10.0 27 18.0 28 12.0 29 20.0 30 19.0 31 34.0 32 38.0 33 46.0 34 88.0 35 107.0 36 268.0 37 862.0 38 1883.0 39 518.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.315871774824082 14.881417774302841 15.741464685952566 45.06124576492051 2 17.548257708698923 25.47004261719729 38.330408623715215 18.65129105038857 3 20.599999999999998 28.849999999999998 27.05 23.5 4 23.724999999999998 34.875 19.875 21.525 5 24.5 35.55 22.95 17.0 6 18.275 37.3 25.2 19.225 7 16.925 17.474999999999998 45.074999999999996 20.525 8 18.925 23.150000000000002 30.15 27.775 9 19.3 23.799999999999997 32.074999999999996 24.825 10-11 23.150000000000002 33.5 21.975 21.375 12-13 19.975 26.6125 30.0 23.4125 14-15 20.375 27.525 29.3375 22.7625 16-17 21.9625 27.825 28.037499999999998 22.175 18-19 21.725 28.3625 27.875 22.037499999999998 20-21 22.075 28.037499999999998 28.125 21.762500000000003 22-23 21.45 27.975 27.650000000000002 22.925 24-25 20.75 28.025 28.299999999999997 22.925 26-27 21.762500000000003 27.775 28.487499999999997 21.975 28-29 21.325 28.675 28.5625 21.4375 30-31 20.825 29.299999999999997 27.85 22.025 32-33 21.7375 28.037499999999998 28.675 21.55 34-35 21.15 28.6625 27.5125 22.675 36-37 21.912499999999998 28.262500000000003 28.012500000000003 21.8125 38-39 21.55 28.212500000000002 28.175 22.0625 40-41 20.925 29.1375 28.249999999999996 21.6875 42-43 22.1375 28.199999999999996 28.1875 21.475 44-45 21.0125 28.849999999999998 27.8375 22.3 46-47 21.825 28.512500000000003 27.800000000000004 21.8625 48-49 21.525 27.462500000000002 28.5875 22.425 50-51 21.6 28.0875 28.675 21.637500000000003 52-53 21.837500000000002 28.787499999999998 27.5875 21.7875 54-55 21.4 28.349999999999998 28.050000000000004 22.2 56-57 22.6875 27.462500000000002 27.487499999999997 22.3625 58-59 20.75 27.925 28.425 22.900000000000002 60-61 21.85 27.224999999999998 29.012500000000003 21.912499999999998 62-63 22.0625 28.249999999999996 28.075 21.6125 64-65 21.125 29.3375 28.050000000000004 21.4875 66-67 21.875 28.212500000000002 27.775 22.1375 68-69 21.7875 28.125 28.449999999999996 21.637500000000003 70-71 22.4625 28.125 27.975 21.4375 72-73 21.7 28.675 28.1625 21.462500000000002 74-75 21.512500000000003 28.287499999999998 27.9375 22.2625 76-77 21.9625 28.8625 27.950000000000003 21.224999999999998 78-79 22.1 28.050000000000004 28.4125 21.4375 80-81 21.9625 27.474999999999998 28.5625 22.0 82-83 22.15 27.712500000000002 28.487499999999997 21.65 84-85 21.7375 28.199999999999996 27.5875 22.475 86-87 22.125 27.975 28.487499999999997 21.4125 88-89 22.7 27.825 27.35 22.125 90-91 22.037499999999998 27.950000000000003 28.775000000000002 21.2375 92-93 21.475 28.3125 28.849999999999998 21.3625 94-95 21.4875 29.012500000000003 27.925 21.575 96-97 21.45 27.9375 27.462500000000002 23.150000000000002 98-99 21.475 28.499999999999996 28.9375 21.087500000000002 100 21.375 27.6 28.275 22.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 1.5 22 1.5 23 2.5 24 3.0 25 4.0 26 5.5 27 6.0 28 9.5 29 19.5 30 28.0 31 38.0 32 50.5 33 55.5 34 61.0 35 73.0 36 89.5 37 107.5 38 155.5 39 196.5 40 198.0 41 220.0 42 248.0 43 257.5 44 260.0 45 245.0 46 242.5 47 245.5 48 228.5 49 200.0 50 164.5 51 124.5 52 92.0 53 77.5 54 61.5 55 47.5 56 36.0 57 27.5 58 23.0 59 20.0 60 13.5 61 8.0 62 6.0 63 4.0 64 3.5 65 3.5 66 4.0 67 3.0 68 4.0 69 5.0 70 2.5 71 0.0 72 2.0 73 3.0 74 1.5 75 1.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.22579026593075763 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTA 6 0.15 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.2 0.0 0.0 0.0 0.0 9 0.2 0.0 0.0 0.0 0.0 10-11 0.2 0.0 0.0 0.0 0.0 12-13 0.2 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.2 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.2 0.0 0.0 0.0 0.0 22-23 0.2 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903631 spots for SRR3207694.sra Written 1903631 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra Read 1903612 spots for SRR3207694.sra Written 1903612 spots for SRR3207694.sra SRR ids: ['SRR3207694.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd___pwur87 SRR3207694.sra spots: 38072259 blocks: [[1, 1903612], [1903613, 3807224], [3807225, 5710836], [5710837, 7614448], [7614449, 9518060], [9518061, 11421672], [11421673, 13325284], [13325285, 15228896], [15228897, 17132508], [17132509, 19036120], [19036121, 20939732], [20939733, 22843344], [22843345, 24746956], [24746957, 26650568], [26650569, 28554180], [28554181, 30457792], [30457793, 32361404], [32361405, 34265016], [34265017, 36168628], [36168629, 38072259]] SRR3207694 file size 9897224 SRR3207694 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207694 SRR3207694_1.fastq Input file: SRR3207694_1.fastq trimmed: SRR3207694-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:47:04 2025 >> started Mon Feb 10 13:47:22 2025 >> done (18.313s) 38072259 reads processed; of these: 4748 ( 0.01%) short reads filtered out after trimming by size control 114483 ( 0.30%) empty reads filtered out after trimming by size control 37953028 (99.69%) reads available; of these: 1287051 ( 3.39%) trimmed reads available after processing 36665977 (96.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 619 0.00% 19 808 0.00% 20 2868 0.01% 21 1269 0.00% 22 1605 0.00% 23 2323 0.01% 24 3066 0.01% 25 4046 0.01% 26 5773 0.02% 27 6426 0.02% 28 5233 0.01% 29 5033 0.01% 30 4358 0.01% 31 4364 0.01% 32 4655 0.01% 33 4216 0.01% 34 4450 0.01% 35 4452 0.01% 36 4647 0.01% 37 4740 0.01% 38 4906 0.01% 39 4944 0.01% 40 5144 0.01% 41 4985 0.01% 42 5610 0.01% 43 5770 0.02% 44 6060 0.02% 45 6286 0.02% 46 6315 0.02% 47 6535 0.02% 48 7027 0.02% 49 6864 0.02% 50 7237 0.02% 51 7337 0.02% 52 7575 0.02% 53 7753 0.02% 54 7699 0.02% 55 8035 0.02% 56 8131 0.02% 57 8322 0.02% 58 8758 0.02% 59 8662 0.02% 60 9128 0.02% 61 9330 0.02% 62 9433 0.02% 63 9207 0.02% 64 9612 0.03% 65 10218 0.03% 66 10585 0.03% 67 10376 0.03% 68 10453 0.03% 69 10892 0.03% 70 11390 0.03% 71 11688 0.03% 72 12475 0.03% 73 12352 0.03% 74 12905 0.03% 75 12685 0.03% 76 9920 0.03% 77 11092 0.03% 78 12494 0.03% 79 13178 0.03% 80 13762 0.04% 81 14746 0.04% 82 16223 0.04% 83 16966 0.04% 84 17803 0.05% 85 18665 0.05% 86 20014 0.05% 87 21594 0.06% 88 23630 0.06% 89 25360 0.07% 90 27920 0.07% 91 31212 0.08% 92 35095 0.09% 93 40445 0.11% 94 48466 0.13% 95 59826 0.16% 96 79441 0.21% 97 93007 0.25% 98 107689 0.28% 99 130868 0.34% 100 36665977 96.61% 37953028 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=21 prefix-density=0.08 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=297.82 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=27.9 sequence=TTCTTCTTCTTC Started job on | Feb 10 13:47:40 Started mapping on | Feb 10 13:47:40 Finished on | Feb 10 13:48:11 Mapping speed, Million of reads per hour | 4407.45 Number of input reads | 37953028 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 35612309 Uniquely mapped reads % | 93.83% Average mapped length | 99.15 Number of splices: Total | 9820229 Number of splices: Annotated (sjdb) | 9629622 Number of splices: GT/AG | 9663723 Number of splices: GC/AG | 126276 Number of splices: AT/AC | 10794 Number of splices: Non-canonical | 19436 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 922470 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 1191304 % of reads mapped to too many loci | 3.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1418249 1418249 1418249 N_multimapping 922470 922470 922470 N_noFeature 1799192 18489366 18690317 N_ambiguous 362031 65687 64997 UnstrandedReadsAssigned:33451086 PositiveStrandReadsAssigned:17057256 NegativeStrandReadsAssigned:16856995 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207694 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207694-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,953,028 reads, 35,242,860 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,280 rounds 52401 SRR3207694.ke.tsv 34699 SRR3207694.se.tsv 87100 total ==> SRR3207694.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2025 43.3283 Potri.005G024800.1.v4.1 1035 936 804 35.2697 Potri.004G059700.1.v4.1 961 862 118 5.62077 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 664.411 9.59243 Potri.016G087400.1.v4.1 270 171 1680 403.399 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 187 4.58677 Potri.012G127500.1.v4.1 977 878 6446 301.451 ==> SRR3207694.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4680 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 536 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 47 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207694 completed mapping pipeline successfully