Starting /dee2/code/volunteer_pipeline.sh SRR3207695 current disk space = 3059073753088 free memory = 1163981792 SRR3207695 SRAfilesize 3ec59acf7ad69f0d274ae2c6b0308da1 SRR3207695.sra SRR3207695.sra file validated SRR3207695 is single end SRR3207695 is conventional basespace SRR3207695 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207695_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35375 38.0 31.0 40.0 19.0 40.0 2 33.28575 36.0 29.0 40.0 22.0 40.0 3 33.26225 36.0 30.0 40.0 22.0 40.0 4 33.439 37.0 30.0 40.0 23.0 40.0 5 33.77525 38.0 31.0 40.0 23.0 40.0 6 34.8175 38.0 32.0 40.0 25.0 40.0 7 34.97625 38.0 33.0 40.0 26.0 40.0 8 34.88075 38.0 32.0 40.0 26.0 40.0 9 35.074 38.0 33.0 40.0 27.0 40.0 10 35.106 38.0 33.0 40.0 27.0 40.0 11 36.005 38.0 34.0 40.0 31.0 40.0 12 35.996 38.0 34.0 40.0 31.0 40.0 13 36.03875 38.0 34.0 40.0 31.0 40.0 14 36.08925 38.0 34.0 40.0 31.0 40.0 15 36.19925 38.0 34.0 40.0 31.0 40.0 16 36.30675 38.0 35.0 40.0 31.0 40.0 17 36.2975 38.0 35.0 40.0 31.0 40.0 18 36.36175 39.0 35.0 40.0 31.0 40.0 19 36.29875 38.0 35.0 40.0 31.0 40.0 20 36.3025 38.0 35.0 40.0 31.0 40.0 21 36.46975 38.0 35.0 40.0 31.0 40.0 22 36.41175 38.0 35.0 40.0 31.0 40.0 23 36.439 38.0 35.0 40.0 31.0 40.0 24 36.58225 39.0 35.0 40.0 31.0 40.0 25 36.53475 38.0 35.0 40.0 31.0 40.0 26 36.6405 39.0 35.0 40.0 31.0 40.0 27 36.95475 39.0 36.0 40.0 31.0 40.0 28 36.846 39.0 36.0 40.0 31.0 40.0 29 36.84725 39.0 36.0 40.0 31.0 40.0 30 36.9325 39.0 36.0 40.0 31.0 40.0 31 36.961 39.0 36.0 40.0 31.0 40.0 32 36.922 39.0 36.0 40.0 31.0 40.0 33 37.21925 39.0 37.0 40.0 32.0 40.0 34 37.2155 39.0 37.0 40.0 32.0 40.0 35 37.279 39.0 37.0 40.0 33.0 40.0 36 37.36775 39.0 38.0 40.0 33.0 40.0 37 37.29075 39.0 37.0 40.0 32.0 40.0 38 37.29425 39.0 37.0 40.0 33.0 40.0 39 37.23125 39.0 37.0 40.0 32.0 40.0 40 37.18575 39.0 37.0 40.0 33.0 40.0 41 37.1895 39.0 37.0 40.0 33.0 40.0 42 37.13 39.0 37.0 40.0 32.0 40.0 43 37.075 39.0 37.0 40.0 32.0 40.0 44 37.08 39.0 37.0 40.0 32.0 40.0 45 37.0635 39.0 37.0 40.0 32.0 40.0 46 36.99925 39.0 37.0 40.0 32.0 40.0 47 37.02125 39.0 37.0 40.0 32.0 40.0 48 36.973 39.0 36.0 40.0 32.0 40.0 49 36.86625 39.0 36.0 40.0 31.0 40.0 50 36.90825 39.0 37.0 40.0 32.0 40.0 51 36.91275 39.0 37.0 40.0 32.0 40.0 52 36.7685 39.0 36.0 40.0 31.0 40.0 53 36.7775 39.0 36.0 40.0 31.0 40.0 54 36.68875 39.0 36.0 40.0 31.0 40.0 55 36.5785 39.0 36.0 40.0 31.0 40.0 56 36.60825 39.0 36.0 40.0 31.0 40.0 57 36.475 39.0 36.0 40.0 31.0 40.0 58 36.44175 39.0 36.0 40.0 31.0 40.0 59 36.2025 39.0 36.0 40.0 31.0 40.0 60 36.14525 39.0 36.0 40.0 31.0 40.0 61 36.1595 39.0 36.0 40.0 31.0 40.0 62 35.84575 38.0 35.0 40.0 30.0 40.0 63 35.982 39.0 35.0 40.0 30.0 40.0 64 35.7475 38.0 35.0 40.0 30.0 40.0 65 35.637 38.0 35.0 40.0 30.0 40.0 66 35.5415 38.0 35.0 40.0 30.0 40.0 67 35.25 38.0 35.0 40.0 29.0 40.0 68 33.87825 36.0 33.0 39.0 27.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 1.0 12 5.0 13 2.0 14 3.0 15 3.0 16 4.0 17 4.0 18 6.0 19 5.0 20 9.0 21 9.0 22 19.0 23 17.0 24 19.0 25 18.0 26 34.0 27 34.0 28 50.0 29 58.0 30 63.0 31 87.0 32 97.0 33 137.0 34 201.0 35 275.0 36 427.0 37 565.0 38 742.0 39 1083.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.216052498738012 14.53811206461383 31.019687026754166 42.226148409893995 2 19.35 25.025 37.5 18.125 3 22.25 30.175 26.55 21.025 4 24.85 33.550000000000004 20.175 21.425 5 24.6 36.575 21.975 16.85 6 17.775 37.275000000000006 25.3 19.650000000000002 7 16.475 16.075 45.525 21.925 8 18.4 23.0 30.45 28.15 9 21.4 22.2 31.2 25.2 10 20.525 38.375 23.525 17.575 11 25.1 27.725 20.75 26.424999999999997 12 21.25 24.325 29.075 25.35 13 20.65 27.700000000000003 30.225 21.425 14 20.175 27.6 30.349999999999998 21.875 15 21.775 26.05 28.475 23.7 16 21.05 27.35 28.175 23.425 17 21.825 28.799999999999997 26.8 22.575 18 21.325 27.975 26.55 24.15 19 21.25 28.825 27.05 22.875 20 21.65 29.45 26.55 22.35 21 21.875 27.925 28.025 22.175 22 21.025 29.625 26.224999999999998 23.125 23 22.3 29.299999999999997 27.200000000000003 21.2 24 20.075000000000003 28.999999999999996 28.625 22.3 25 20.474999999999998 28.175 28.449999999999996 22.900000000000002 26 21.575 29.4 28.075 20.95 27 21.4 28.025 27.425 23.150000000000002 28 21.6 28.249999999999996 28.575 21.575 29 21.3 29.025000000000002 27.625 22.05 30 20.575 29.049999999999997 28.050000000000004 22.325 31 21.05 27.750000000000004 29.375 21.825 32 22.05 28.075 28.375 21.5 33 21.8 27.975 27.900000000000002 22.325 34 20.075000000000003 28.875 28.475 22.575 35 22.175 29.7 27.3 20.825 36 22.025 28.175 28.025 21.775 37 22.400000000000002 26.900000000000002 27.85 22.85 38 21.975 27.900000000000002 29.325000000000003 20.8 39 21.65 29.349999999999998 27.224999999999998 21.775 40 21.625 29.075 27.525 21.775 41 22.400000000000002 28.425 27.575 21.6 42 20.775 28.875 28.349999999999998 22.0 43 22.025 27.900000000000002 27.025 23.05 44 21.2 29.049999999999997 28.225 21.525 45 20.674999999999997 27.825 28.549999999999997 22.95 46 20.525 27.750000000000004 28.7 23.025000000000002 47 22.275 26.950000000000003 28.675 22.1 48 21.825 27.325 28.199999999999996 22.650000000000002 49 21.575 27.975 28.125 22.325 50 22.45 28.349999999999998 27.325 21.875 51 21.875 29.275000000000002 27.55 21.3 52 23.075000000000003 27.474999999999998 27.125 22.325 53 21.25 28.125 27.55 23.075000000000003 54 21.975 28.65 28.675 20.7 55 21.7 28.349999999999998 27.975 21.975 56 22.25 28.999999999999996 26.650000000000002 22.1 57 20.775 27.950000000000003 28.775000000000002 22.5 58 21.125 28.325 28.775000000000002 21.775 59 21.375 28.975 27.275 22.375 60 21.075 27.800000000000004 28.325 22.8 61 21.6 28.4 28.575 21.425 62 22.35 28.875 27.650000000000002 21.125 63 21.65 28.799999999999997 27.900000000000002 21.65 64 21.025 28.175 27.900000000000002 22.900000000000002 65 21.875 28.9 28.199999999999996 21.025 66 21.825 27.775 28.000000000000004 22.400000000000002 67 20.825 28.499999999999996 27.325 23.35 68 21.075 27.525 28.725 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.5 22 3.0 23 5.0 24 9.5 25 12.0 26 14.5 27 18.5 28 20.0 29 27.0 30 46.5 31 59.0 32 79.0 33 109.0 34 119.0 35 132.0 36 167.5 37 190.0 38 222.0 39 275.5 40 304.5 41 312.0 42 341.0 43 349.0 44 328.0 45 329.5 46 325.5 47 320.0 48 282.5 49 240.0 50 235.0 51 214.0 52 156.5 53 120.0 54 105.5 55 78.0 56 65.0 57 49.0 58 31.5 59 30.0 60 24.0 61 18.0 62 18.0 63 13.5 64 9.0 65 8.0 66 7.0 67 5.5 68 2.0 69 0.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77409638554217 99.375 2 0.1757028112449799 0.35000000000000003 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0251004016064257 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTGAAA 7 0.17500000000000002 TruSeq Adapter, Index 14 (97% over 41bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10 0.175 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.2 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.2 0.0 0.0 0.0 0.0 32 0.2 0.0 0.0 0.0 0.0 33 0.2 0.0 0.0 0.0 0.0 34 0.2 0.0 0.0 0.0 0.0 35 0.2 0.0 0.0 0.0 0.0 36 0.2 0.0 0.0 0.0 0.0 37 0.2 0.0 0.0 0.0 0.0 38 0.2 0.0 0.0 0.0 0.0 39 0.2 0.0 0.0 0.0 0.0 40 0.2 0.0 0.0 0.0 0.0 41 0.2 0.0 0.0 0.0 0.0 42 0.2 0.0 0.0 0.0 0.0 43 0.2 0.0 0.0 0.0 0.0 44 0.2 0.0 0.0 0.0 0.0 45 0.2 0.0 0.0 0.0 0.0 46 0.2 0.0 0.0 0.0 0.0 47 0.2 0.0 0.0 0.0 0.0 48 0.2 0.0 0.0 0.0 0.0 49 0.225 0.0 0.0 0.0 0.0 50 0.225 0.0 0.0 0.0 0.0 51 0.225 0.0 0.0 0.0 0.0 52 0.225 0.0 0.0 0.0 0.0 53 0.225 0.0 0.0 0.0 0.0 54 0.225 0.0 0.0 0.0 0.0 55 0.225 0.0 0.0 0.0 0.0 56 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164217 spots for SRR3207695.sra Written 164217 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra Read 164199 spots for SRR3207695.sra Written 164199 spots for SRR3207695.sra SRR ids: ['SRR3207695.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i_kvmxfd SRR3207695.sra spots: 3283998 blocks: [[1, 164199], [164200, 328398], [328399, 492597], [492598, 656796], [656797, 820995], [820996, 985194], [985195, 1149393], [1149394, 1313592], [1313593, 1477791], [1477792, 1641990], [1641991, 1806189], [1806190, 1970388], [1970389, 2134587], [2134588, 2298786], [2298787, 2462985], [2462986, 2627184], [2627185, 2791383], [2791384, 2955582], [2955583, 3119781], [3119782, 3283998]] SRR3207695 file size 685812 SRR3207695 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207695 SRR3207695_1.fastq Input file: SRR3207695_1.fastq trimmed: SRR3207695-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:46:36 2025 >> started Mon Feb 10 13:46:37 2025 >> done (1.641s) 3283998 reads processed; of these: 18020 ( 0.55%) short reads filtered out after trimming by size control 25853 ( 0.79%) empty reads filtered out after trimming by size control 3240125 (98.66%) reads available; of these: 217362 ( 6.71%) trimmed reads available after processing 3022763 (93.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 744 0.02% 19 1240 0.04% 20 2648 0.08% 21 653 0.02% 22 828 0.03% 23 1172 0.04% 24 1923 0.06% 25 3966 0.12% 26 1013 0.03% 27 992 0.03% 28 1369 0.04% 29 2028 0.06% 30 3519 0.11% 31 998 0.03% 32 1310 0.04% 33 1346 0.04% 34 2145 0.07% 35 3948 0.12% 36 1038 0.03% 37 1300 0.04% 38 1811 0.06% 39 2998 0.09% 40 5761 0.18% 41 1244 0.04% 42 1604 0.05% 43 2219 0.07% 44 3717 0.11% 45 6941 0.21% 46 1542 0.05% 47 1898 0.06% 48 2801 0.09% 49 4626 0.14% 50 8690 0.27% 51 1986 0.06% 52 2518 0.08% 53 3541 0.11% 54 6234 0.19% 55 11887 0.37% 56 2492 0.08% 57 3469 0.11% 58 5036 0.16% 59 8785 0.27% 60 17986 0.56% 61 3375 0.10% 62 4765 0.15% 63 7239 0.22% 64 12712 0.39% 65 23630 0.73% 66 5529 0.17% 67 16146 0.50% 68 3022763 93.29% 3240125 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.04 prefix-fanout=2.0 sequence=TACAACATCCAGAAGGAGTCCACCCTCCACTTGGTGCTTCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=181.53 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=21.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 13:46:53 Started mapping on | Feb 10 13:46:53 Finished on | Feb 10 13:46:57 Mapping speed, Million of reads per hour | 2916.11 Number of input reads | 3240125 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 3059883 Uniquely mapped reads % | 94.44% Average mapped length | 66.88 Number of splices: Total | 560151 Number of splices: Annotated (sjdb) | 550631 Number of splices: GT/AG | 551473 Number of splices: GC/AG | 7096 Number of splices: AT/AC | 712 Number of splices: Non-canonical | 870 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 108874 % of reads mapped to multiple loci | 3.36% Number of reads mapped to too many loci | 52379 % of reads mapped to too many loci | 1.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 71368 71368 71368 N_multimapping 108874 108874 108874 N_noFeature 153232 1597589 1596422 N_ambiguous 29159 5020 5074 UnstrandedReadsAssigned:2877492 PositiveStrandReadsAssigned:1457274 NegativeStrandReadsAssigned:1458387 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207695 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207695-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,240,125 reads, 2,989,095 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52401 SRR3207695.ke.tsv 34699 SRR3207695.se.tsv 87100 total ==> SRR3207695.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 175.496 45.4701 Potri.005G024800.1.v4.1 1035 936 85 45.152 Potri.004G059700.1.v4.1 961 862 3 1.73041 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.6444 10.0777 Potri.016G087400.1.v4.1 270 171 101 293.67 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12.6532 3.75819 Potri.012G127500.1.v4.1 977 878 670 379.415 ==> SRR3207695.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 400 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 51 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207695 completed mapping pipeline successfully