Starting /dee2/code/volunteer_pipeline.sh SRR3207696 current disk space = 3059095056384 free memory = 1215527360 SRR3207696 SRAfilesize 4848f6281f3ef5990347a7cdbcac8903 SRR3207696.sra SRR3207696.sra file validated SRR3207696 is single end SRR3207696 is conventional basespace SRR3207696 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207696_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7815 34.0 33.0 34.0 31.0 34.0 2 33.177 34.0 34.0 34.0 31.0 34.0 3 33.47775 34.0 34.0 34.0 31.0 34.0 4 36.717 37.0 37.0 37.0 35.0 37.0 5 36.705 37.0 37.0 37.0 35.0 37.0 6 36.69025 37.0 37.0 37.0 36.0 37.0 7 36.59875 37.0 37.0 37.0 35.0 37.0 8 36.64975 37.0 37.0 37.0 35.0 37.0 9 38.631 39.0 39.0 39.0 38.0 39.0 10-11 38.62325 39.0 39.0 39.0 38.0 39.0 12-13 38.548125 39.0 39.0 39.0 37.5 39.0 14-15 40.236875 41.0 40.0 41.0 38.5 41.0 16-17 40.234875 41.0 40.0 41.0 38.5 41.0 18-19 40.1425 41.0 40.0 41.0 38.5 41.0 20-21 40.201625 41.0 40.0 41.0 39.0 41.0 22-23 40.17225 41.0 40.0 41.0 39.0 41.0 24-25 40.046875 41.0 40.0 41.0 38.0 41.0 26-27 39.961375000000004 41.0 40.0 41.0 38.0 41.0 28-29 39.923874999999995 41.0 40.0 41.0 38.0 41.0 30-31 39.80475 41.0 40.0 41.0 38.0 41.0 32-33 39.801874999999995 41.0 40.0 41.0 38.0 41.0 34-35 39.83925 41.0 40.0 41.0 38.0 41.0 36-37 39.716750000000005 41.0 40.0 41.0 38.0 41.0 38-39 39.666 41.0 40.0 41.0 37.5 41.0 40-41 39.715125 41.0 40.0 41.0 37.5 41.0 42-43 39.766999999999996 41.0 40.0 41.0 37.5 41.0 44-45 39.706500000000005 41.0 40.0 41.0 37.5 41.0 46-47 39.663124999999994 41.0 40.0 41.0 37.0 41.0 48-49 39.588750000000005 41.0 40.0 41.0 37.0 41.0 50-51 39.378125 41.0 40.0 41.0 36.5 41.0 52-53 39.39 41.0 39.0 41.0 36.0 41.0 54-55 39.223749999999995 41.0 39.0 41.0 35.0 41.0 56-57 39.019625 41.0 39.0 41.0 35.0 41.0 58-59 38.82725000000001 40.5 38.5 41.0 35.0 41.0 60-61 38.5865 40.0 37.5 41.0 35.0 41.0 62-63 38.34025 40.0 37.0 41.0 35.0 41.0 64-65 38.057625 39.5 37.0 41.0 34.0 41.0 66-67 37.744749999999996 39.0 36.0 41.0 34.0 41.0 68-69 37.4015 39.0 36.0 41.0 34.0 41.0 70-71 36.96725 38.0 35.0 40.0 34.0 41.0 72-73 36.4555 37.0 35.0 39.0 33.0 41.0 74-75 35.916124999999994 37.0 35.0 39.0 33.0 40.5 76-77 35.018125 35.5 34.5 37.0 31.5 39.0 78-79 35.00875 35.5 35.0 37.0 32.5 39.0 80-81 34.742875 35.0 35.0 37.0 33.0 39.0 82-83 34.56037499999999 35.0 35.0 36.0 32.5 37.0 84-85 34.21575 35.0 35.0 36.0 32.0 37.0 86-87 33.998875 35.0 35.0 36.0 32.0 37.0 88-89 33.914125 35.0 35.0 35.0 32.0 36.0 90-91 33.800375 35.0 35.0 35.0 32.0 36.0 92-93 33.6075 35.0 34.0 35.0 31.5 36.0 94-95 33.46 35.0 34.0 35.0 31.0 36.0 96-97 33.305875 35.0 34.0 35.0 31.0 35.5 98-99 33.1365 35.0 34.0 35.0 31.0 35.0 100 33.06375 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 2.0 14 3.0 15 3.0 16 1.0 17 2.0 18 1.0 19 3.0 20 4.0 21 9.0 22 7.0 23 4.0 24 8.0 25 6.0 26 6.0 27 13.0 28 22.0 29 16.0 30 15.0 31 26.0 32 41.0 33 44.0 34 84.0 35 129.0 36 256.0 37 811.0 38 1963.0 39 518.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.85502807554875 14.216436957631446 15.441551812149058 44.48698315467075 2 18.122653316645806 24.005006257822277 37.79724655819774 20.075093867334168 3 21.0 28.549999999999997 26.200000000000003 24.25 4 23.375 33.925 20.325 22.375 5 23.5 35.225 23.799999999999997 17.474999999999998 6 19.325 37.875 24.925 17.875 7 16.05 16.925 45.550000000000004 21.475 8 18.925 21.775 30.9 28.4 9 20.474999999999998 23.125 31.225 25.174999999999997 10-11 23.625 33.7625 21.6125 21.0 12-13 19.775000000000002 26.6 29.8375 23.7875 14-15 21.1875 27.35 28.762500000000003 22.7 16-17 21.15 27.875 28.375 22.6 18-19 21.625 28.525 27.5625 22.287499999999998 20-21 21.712500000000002 28.3125 28.012500000000003 21.9625 22-23 21.912499999999998 28.462500000000002 27.750000000000004 21.875 24-25 21.85 29.099999999999998 27.425 21.625 26-27 21.075 28.237499999999997 28.425 22.2625 28-29 21.837500000000002 28.3625 27.3625 22.4375 30-31 21.587500000000002 28.5875 27.875 21.95 32-33 21.9625 29.075 26.787499999999998 22.175 34-35 22.425 28.000000000000004 27.5875 21.987499999999997 36-37 21.05 29.125 28.125 21.7 38-39 21.325 28.4375 27.5875 22.650000000000002 40-41 21.9 28.549999999999997 27.900000000000002 21.65 42-43 21.087500000000002 28.012500000000003 29.225 21.675 44-45 22.900000000000002 28.1 27.400000000000002 21.6 46-47 21.224999999999998 28.475 28.375 21.925 48-49 21.4875 28.537499999999998 27.8875 22.0875 50-51 22.112499999999997 28.1375 27.425 22.325 52-53 20.974999999999998 28.975 28.4125 21.637500000000003 54-55 21.3125 27.712500000000002 27.925 23.05 56-57 20.962500000000002 27.925 28.225 22.8875 58-59 21.95 29.1125 27.2625 21.675 60-61 21.8 27.5125 28.0875 22.6 62-63 21.712500000000002 28.4375 27.925 21.925 64-65 21.337500000000002 27.8625 28.487499999999997 22.3125 66-67 22.05 28.599999999999998 27.55 21.8 68-69 21.8625 28.050000000000004 27.975 22.112499999999997 70-71 22.3125 27.8125 28.6625 21.212500000000002 72-73 21.85 28.1625 28.1 21.8875 74-75 21.587500000000002 27.3625 28.449999999999996 22.6 76-77 22.325 27.6875 27.962500000000002 22.025 78-79 21.6625 27.55 28.037499999999998 22.75 80-81 21.9375 28.325 27.437499999999996 22.3 82-83 21.7875 27.6125 28.812500000000004 21.7875 84-85 22.4625 28.775000000000002 27.325 21.4375 86-87 22.325 28.3625 28.025 21.2875 88-89 21.825 28.3875 28.175 21.6125 90-91 22.125 27.800000000000004 27.712500000000002 22.3625 92-93 22.4875 27.800000000000004 28.525 21.1875 94-95 22.225 28.1625 27.4125 22.2 96-97 22.2125 28.775000000000002 28.0875 20.925 98-99 22.4875 27.762500000000003 27.437499999999996 22.3125 100 21.375 28.475 28.65 21.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.5 25 3.5 26 6.5 27 8.5 28 12.0 29 13.0 30 17.5 31 25.5 32 31.0 33 41.0 34 59.0 35 80.0 36 103.5 37 120.0 38 144.0 39 181.0 40 201.5 41 237.5 42 253.5 43 250.0 44 253.5 45 245.0 46 259.0 47 249.5 48 211.0 49 187.0 50 156.5 51 129.0 52 112.5 53 92.0 54 65.0 55 49.5 56 42.0 57 31.0 58 24.5 59 17.5 60 14.0 61 11.5 62 10.0 63 8.5 64 6.0 65 3.5 66 4.0 67 4.5 68 2.5 69 2.0 70 0.5 71 1.0 72 1.5 73 1.5 74 1.0 75 1.5 76 1.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.0625 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081469 spots for SRR3207696.sra Written 1081469 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra Read 1081452 spots for SRR3207696.sra Written 1081452 spots for SRR3207696.sra SRR ids: ['SRR3207696.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjuo15xn SRR3207696.sra spots: 21629057 blocks: [[1, 1081452], [1081453, 2162904], [2162905, 3244356], [3244357, 4325808], [4325809, 5407260], [5407261, 6488712], [6488713, 7570164], [7570165, 8651616], [8651617, 9733068], [9733069, 10814520], [10814521, 11895972], [11895973, 12977424], [12977425, 14058876], [14058877, 15140328], [15140329, 16221780], [16221781, 17303232], [17303233, 18384684], [18384685, 19466136], [19466137, 20547588], [20547589, 21629057]] SRR3207696 file size 5618001 SRR3207696 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207696 SRR3207696_1.fastq Input file: SRR3207696_1.fastq trimmed: SRR3207696-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:49:19 2025 >> started Mon Feb 10 13:49:29 2025 >> done (10.514s) 21629057 reads processed; of these: 2703 ( 0.01%) short reads filtered out after trimming by size control 48143 ( 0.22%) empty reads filtered out after trimming by size control 21578211 (99.76%) reads available; of these: 729416 ( 3.38%) trimmed reads available after processing 20848795 (96.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 388 0.00% 19 433 0.00% 20 566 0.00% 21 612 0.00% 22 973 0.00% 23 1342 0.01% 24 1743 0.01% 25 2210 0.01% 26 3090 0.01% 27 3559 0.02% 28 2786 0.01% 29 2769 0.01% 30 2637 0.01% 31 2505 0.01% 32 2480 0.01% 33 2351 0.01% 34 2575 0.01% 35 2518 0.01% 36 2567 0.01% 37 2652 0.01% 38 2743 0.01% 39 2769 0.01% 40 2927 0.01% 41 2741 0.01% 42 3029 0.01% 43 3239 0.02% 44 3222 0.01% 45 3420 0.02% 46 3454 0.02% 47 3638 0.02% 48 3704 0.02% 49 3969 0.02% 50 4036 0.02% 51 4170 0.02% 52 4351 0.02% 53 4250 0.02% 54 4420 0.02% 55 4448 0.02% 56 4539 0.02% 57 4764 0.02% 58 4915 0.02% 59 5024 0.02% 60 5018 0.02% 61 5000 0.02% 62 5316 0.02% 63 5237 0.02% 64 5499 0.03% 65 5686 0.03% 66 6283 0.03% 67 6067 0.03% 68 6153 0.03% 69 6146 0.03% 70 6465 0.03% 71 6789 0.03% 72 7019 0.03% 73 7165 0.03% 74 7365 0.03% 75 7270 0.03% 76 5596 0.03% 77 6247 0.03% 78 7081 0.03% 79 7583 0.04% 80 7883 0.04% 81 8434 0.04% 82 9258 0.04% 83 9597 0.04% 84 10107 0.05% 85 10701 0.05% 86 11304 0.05% 87 12252 0.06% 88 13637 0.06% 89 14532 0.07% 90 16212 0.08% 91 17581 0.08% 92 20067 0.09% 93 23176 0.11% 94 27738 0.13% 95 33845 0.16% 96 45600 0.21% 97 52805 0.24% 98 61006 0.28% 99 74168 0.34% 100 20848795 96.62% 21578211 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=47.09 fanout-score-rank=5 prefix-density=0.28 prefix-fanout=31.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=283.30 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.8 sequence=TTCTTCTTCTTT Started job on | Feb 10 13:50:03 Started mapping on | Feb 10 13:50:03 Finished on | Feb 10 13:50:23 Mapping speed, Million of reads per hour | 3884.08 Number of input reads | 21578211 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 20153030 Uniquely mapped reads % | 93.40% Average mapped length | 99.11 Number of splices: Total | 5590548 Number of splices: Annotated (sjdb) | 5486003 Number of splices: GT/AG | 5502726 Number of splices: GC/AG | 71130 Number of splices: AT/AC | 6024 Number of splices: Non-canonical | 10668 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510318 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 785526 % of reads mapped to too many loci | 3.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 914863 914863 914863 N_multimapping 510318 510318 510318 N_noFeature 954582 10446093 10515022 N_ambiguous 218804 36172 36398 UnstrandedReadsAssigned:18979644 PositiveStrandReadsAssigned:9670765 NegativeStrandReadsAssigned:9601610 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207696 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207696-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,578,211 reads, 20,086,753 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR3207696.ke.tsv 34699 SRR3207696.se.tsv 87100 total ==> SRR3207696.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 636 24.2364 Potri.005G024800.1.v4.1 1035 936 156 12.1881 Potri.004G059700.1.v4.1 961 862 108 9.16226 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 381.419 9.80752 Potri.016G087400.1.v4.1 270 171 884 378.044 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 101.623 4.43939 Potri.012G127500.1.v4.1 977 878 3209 267.277 ==> SRR3207696.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2695 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207696 completed mapping pipeline successfully