Starting /dee2/code/volunteer_pipeline.sh SRR3207697 current disk space = 3059037155328 free memory = 1155359040 SRR3207697 SRAfilesize 77763314426acd26a474752d336eec06 SRR3207697.sra SRR3207697.sra file validated SRR3207697 is single end SRR3207697 is conventional basespace SRR3207697 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.798 38.0 30.0 39.0 19.0 40.0 2 33.37875 37.0 30.0 40.0 22.0 40.0 3 33.2805 37.0 31.0 40.0 22.0 40.0 4 33.44 38.0 31.0 40.0 22.0 40.0 5 33.7685 38.0 31.0 40.0 22.0 40.0 6 34.7555 38.0 33.0 40.0 25.0 40.0 7 34.857 38.0 33.0 40.0 25.0 40.0 8 34.8575 38.0 33.0 40.0 25.0 40.0 9 34.96925 38.0 33.0 40.0 25.0 40.0 10 35.09425 38.0 33.0 40.0 25.0 40.0 11 36.2185 38.0 34.0 40.0 31.0 40.0 12 36.246 38.0 34.0 40.0 31.0 40.0 13 36.16225 38.0 34.0 40.0 31.0 40.0 14 36.2215 38.0 35.0 40.0 31.0 40.0 15 36.33525 39.0 35.0 40.0 31.0 40.0 16 36.46825 39.0 35.0 40.0 31.0 40.0 17 36.42675 39.0 35.0 40.0 31.0 40.0 18 36.54825 39.0 35.0 40.0 31.0 40.0 19 36.49025 39.0 35.0 40.0 31.0 40.0 20 36.41275 39.0 35.0 40.0 31.0 40.0 21 36.463 39.0 35.0 40.0 31.0 40.0 22 36.4425 39.0 35.0 40.0 31.0 40.0 23 36.47175 39.0 35.0 40.0 31.0 40.0 24 36.507 39.0 35.0 40.0 31.0 40.0 25 36.45325 39.0 35.0 40.0 31.0 40.0 26 36.5185 39.0 35.0 40.0 31.0 40.0 27 36.86425 39.0 36.0 40.0 31.0 40.0 28 36.755 39.0 36.0 40.0 31.0 40.0 29 36.77675 39.0 36.0 40.0 31.0 40.0 30 36.7725 39.0 36.0 40.0 31.0 40.0 31 36.85525 39.0 36.0 40.0 31.0 40.0 32 36.8005 39.0 36.0 40.0 31.0 40.0 33 37.01175 39.0 36.0 40.0 31.0 40.0 34 36.96475 39.0 37.0 40.0 31.0 40.0 35 36.9175 39.0 37.0 40.0 31.0 40.0 36 37.0105 39.0 37.0 40.0 31.0 40.0 37 36.911 39.0 36.0 40.0 31.0 40.0 38 36.9545 39.0 36.0 40.0 31.0 40.0 39 36.92675 39.0 36.0 40.0 31.0 40.0 40 36.85925 39.0 36.0 40.0 31.0 40.0 41 36.77275 39.0 36.0 40.0 31.0 40.0 42 36.7375 39.0 36.0 40.0 31.0 40.0 43 36.68725 39.0 36.0 40.0 31.0 40.0 44 36.64625 39.0 36.0 40.0 31.0 40.0 45 36.58525 39.0 36.0 40.0 31.0 40.0 46 36.59225 39.0 36.0 40.0 31.0 40.0 47 36.521 39.0 36.0 40.0 31.0 40.0 48 36.43825 39.0 36.0 40.0 31.0 40.0 49 36.31725 39.0 36.0 40.0 31.0 40.0 50 36.39575 39.0 36.0 40.0 31.0 40.0 51 36.334 39.0 36.0 40.0 31.0 40.0 52 36.17725 39.0 35.0 40.0 31.0 40.0 53 36.112 39.0 35.0 40.0 31.0 40.0 54 35.99525 39.0 35.0 40.0 30.0 40.0 55 35.8925 39.0 35.0 40.0 30.0 40.0 56 35.881 39.0 35.0 40.0 31.0 40.0 57 35.71375 38.0 35.0 40.0 30.0 40.0 58 35.77 38.0 35.0 40.0 30.0 40.0 59 35.56275 38.0 35.0 40.0 30.0 40.0 60 35.50525 38.0 35.0 40.0 30.0 40.0 61 35.26375 38.0 35.0 40.0 29.0 40.0 62 34.82475 38.0 33.0 39.0 28.0 40.0 63 34.957 38.0 34.0 39.0 29.0 40.0 64 34.73325 38.0 34.0 39.0 28.0 40.0 65 34.4775 38.0 33.0 39.0 27.0 40.0 66 34.335 38.0 33.0 39.0 27.0 40.0 67 34.0615 37.0 33.0 39.0 27.0 40.0 68 32.7335 36.0 31.0 38.0 23.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 0.0 5 2.0 6 3.0 7 2.0 8 4.0 9 1.0 10 2.0 11 3.0 12 1.0 13 6.0 14 4.0 15 5.0 16 3.0 17 4.0 18 4.0 19 7.0 20 8.0 21 14.0 22 14.0 23 22.0 24 18.0 25 29.0 26 34.0 27 62.0 28 64.0 29 80.0 30 55.0 31 89.0 32 85.0 33 119.0 34 184.0 35 267.0 36 450.0 37 617.0 38 756.0 39 958.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.854338842975206 15.883264462809917 31.12086776859504 41.14152892561984 2 20.525 25.724999999999998 36.025 17.724999999999998 3 21.55 28.95 28.1 21.4 4 24.05 33.550000000000004 21.525 20.875 5 25.624999999999996 33.825 22.2 18.35 6 19.475 36.625 25.45 18.45 7 16.900000000000002 17.4 45.550000000000004 20.150000000000002 8 18.875 24.25 30.049999999999997 26.825 9 20.025000000000002 23.325000000000003 31.8 24.85 10 20.875 38.95 24.0 16.175 11 26.150000000000002 29.725 20.075000000000003 24.05 12 20.150000000000002 24.75 28.799999999999997 26.3 13 18.05 28.599999999999998 31.525 21.825 14 21.75 28.1 28.575 21.575 15 20.625 29.125 26.75 23.5 16 20.525 29.625 28.15 21.7 17 21.8 28.375 26.924999999999997 22.900000000000002 18 20.724999999999998 28.375 28.15 22.75 19 20.825 27.975 29.349999999999998 21.85 20 23.025000000000002 27.150000000000002 27.224999999999998 22.6 21 22.075 27.675 28.025 22.225 22 21.75 29.549999999999997 26.825 21.875 23 20.825 31.05 26.875 21.25 24 19.650000000000002 30.65 26.924999999999997 22.775000000000002 25 21.725 28.1 28.050000000000004 22.125 26 21.375 29.475 28.249999999999996 20.9 27 21.9 27.775 26.375 23.95 28 21.175 29.849999999999998 26.375 22.6 29 22.400000000000002 28.725 27.725 21.15 30 21.375 27.875 29.049999999999997 21.7 31 20.974999999999998 28.125 28.125 22.775000000000002 32 20.925 28.7 27.900000000000002 22.475 33 19.975 28.9 28.050000000000004 23.075000000000003 34 20.599999999999998 29.65 27.625 22.125 35 22.5 27.725 28.15 21.625 36 20.849999999999998 28.15 28.799999999999997 22.2 37 21.125 27.975 29.525000000000002 21.375 38 21.0 28.4 28.65 21.95 39 20.9 29.425 27.750000000000004 21.925 40 21.6 29.225 27.525 21.65 41 21.4 29.65 27.125 21.825 42 21.55 29.075 28.050000000000004 21.325 43 21.25 29.15 29.2 20.4 44 20.7 27.85 28.625 22.825 45 21.425 27.750000000000004 27.725 23.1 46 21.025 27.700000000000003 29.4 21.875 47 22.85 26.85 27.125 23.175 48 20.925 29.65 27.950000000000003 21.475 49 22.0 28.199999999999996 29.625 20.175 50 21.775 28.725 28.875 20.625 51 21.475 27.450000000000003 28.825 22.25 52 22.1 28.15 28.275 21.475 53 20.9 28.475 28.075 22.55 54 21.55 27.55 28.675 22.225 55 23.425 28.000000000000004 27.025 21.55 56 21.349999999999998 27.625 29.475 21.55 57 19.575 27.775 30.175 22.475 58 20.95 27.975 30.049999999999997 21.025 59 21.75 27.625 28.799999999999997 21.825 60 20.925 27.750000000000004 29.325000000000003 22.0 61 21.175 28.95 27.975 21.9 62 21.85 29.049999999999997 27.075 22.025 63 22.575 27.175 27.925 22.325 64 21.85 28.999999999999996 27.900000000000002 21.25 65 21.55 28.325 28.799999999999997 21.325 66 22.075 29.599999999999998 27.700000000000003 20.625 67 22.15 29.5 26.75 21.6 68 21.575 30.125 27.150000000000002 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 3.0 17 1.5 18 1.0 19 2.0 20 4.0 21 9.0 22 12.0 23 8.5 24 8.5 25 12.0 26 16.0 27 29.5 28 39.0 29 38.0 30 53.5 31 70.0 32 86.5 33 101.0 34 99.0 35 126.0 36 189.5 37 226.0 38 249.5 39 275.0 40 280.0 41 283.0 42 316.5 43 360.5 44 371.0 45 351.0 46 328.5 47 326.0 48 290.0 49 227.0 50 200.0 51 185.0 52 145.0 53 120.0 54 104.5 55 73.0 56 57.0 57 51.0 58 31.0 59 17.0 60 16.5 61 14.5 62 13.0 63 8.5 64 4.0 65 3.0 66 2.0 67 2.0 68 1.5 69 1.0 70 1.0 71 1.5 72 2.0 73 1.5 74 0.5 75 0.0 76 1.0 77 1.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72123669538774 98.375 2 0.1773948302078054 0.35000000000000003 3 0.05068423720223011 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05068423720223011 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAA 30 0.75 TruSeq Adapter, Index 15 (97% over 40bp) TATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAA 15 0.375 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.825 0.0 0.0 0.0 0.0 2 0.825 0.0 0.0 0.0 0.0 3 0.825 0.0 0.0 0.0 0.0 4 0.85 0.0 0.0 0.0 0.0 5 0.85 0.0 0.0 0.0 0.0 6 0.875 0.0 0.0 0.0 0.0 7 0.875 0.0 0.0 0.0 0.0 8 0.875 0.0 0.0 0.0 0.0 9 0.875 0.0 0.0 0.0 0.0 10 0.875 0.0 0.0 0.0 0.0 11 0.875 0.0 0.0 0.0 0.0 12 0.875 0.0 0.0 0.0 0.0 13 0.875 0.0 0.0 0.0 0.0 14 0.875 0.0 0.0 0.0 0.0 15 0.875 0.0 0.0 0.0 0.0 16 0.875 0.0 0.0 0.0 0.0 17 0.875 0.0 0.0 0.0 0.0 18 0.875 0.0 0.0 0.0 0.0 19 0.875 0.0 0.0 0.0 0.0 20 0.875 0.0 0.0 0.0 0.0 21 0.875 0.0 0.0 0.0 0.0 22 0.875 0.0 0.0 0.0 0.0 23 0.875 0.0 0.0 0.0 0.0 24 0.875 0.0 0.0 0.0 0.0 25 0.875 0.0 0.0 0.0 0.0 26 0.875 0.0 0.0 0.0 0.0 27 0.875 0.0 0.0 0.0 0.0 28 0.875 0.0 0.0 0.0 0.0 29 0.875 0.0 0.0 0.0 0.0 30 0.875 0.0 0.0 0.0 0.0 31 0.875 0.0 0.0 0.0 0.0 32 0.875 0.0 0.0 0.0 0.0 33 0.875 0.0 0.0 0.0 0.0 34 0.875 0.0 0.0 0.0 0.0 35 0.875 0.0 0.0 0.0 0.0 36 0.875 0.0 0.0 0.0 0.0 37 0.875 0.0 0.0 0.0 0.0 38 0.875 0.0 0.0 0.0 0.0 39 0.875 0.0 0.0 0.0 0.0 40 0.875 0.0 0.0 0.0 0.0 41 0.875 0.0 0.0 0.0 0.0 42 0.875 0.0 0.0 0.0 0.0 43 0.875 0.0 0.0 0.0 0.0 44 0.875 0.0 0.0 0.0 0.0 45 0.875 0.0 0.0 0.0 0.0 46 0.875 0.0 0.0 0.0 0.0 47 0.875 0.0 0.0 0.0 0.0 48 0.875 0.0 0.0 0.0 0.0 49 0.875 0.0 0.0 0.0 0.0 50 0.875 0.0 0.0 0.0 0.0 51 0.875 0.0 0.0 0.0 0.0 52 0.875 0.0 0.0 0.0 0.0 53 0.875 0.0 0.0 0.0 0.0 54 0.875 0.0 0.0 0.0 0.0 55 0.875 0.0 0.0 0.0 0.0 56 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489773 spots for SRR3207697.sra Written 489773 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra Read 489767 spots for SRR3207697.sra Written 489767 spots for SRR3207697.sra SRR ids: ['SRR3207697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ggz4jl3n SRR3207697.sra spots: 9795346 blocks: [[1, 489767], [489768, 979534], [979535, 1469301], [1469302, 1959068], [1959069, 2448835], [2448836, 2938602], [2938603, 3428369], [3428370, 3918136], [3918137, 4407903], [4407904, 4897670], [4897671, 5387437], [5387438, 5877204], [5877205, 6366971], [6366972, 6856738], [6856739, 7346505], [7346506, 7836272], [7836273, 8326039], [8326040, 8815806], [8815807, 9305573], [9305574, 9795346]] SRR3207697 file size 2047762 SRR3207697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207697 SRR3207697_1.fastq Input file: SRR3207697_1.fastq trimmed: SRR3207697-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:44:26 2025 >> started Mon Feb 10 13:44:42 2025 >> done (15.890s) 9795346 reads processed; of these: 52824 ( 0.54%) short reads filtered out after trimming by size control 231556 ( 2.36%) empty reads filtered out after trimming by size control 9510966 (97.10%) reads available; of these: 621988 ( 6.54%) trimmed reads available after processing 8888978 (93.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2221 0.02% 19 3717 0.04% 20 7410 0.08% 21 1858 0.02% 22 2424 0.03% 23 3332 0.04% 24 5542 0.06% 25 11093 0.12% 26 2837 0.03% 27 2966 0.03% 28 3838 0.04% 29 5876 0.06% 30 10574 0.11% 31 2875 0.03% 32 3935 0.04% 33 4511 0.05% 34 6320 0.07% 35 11281 0.12% 36 2914 0.03% 37 3759 0.04% 38 5373 0.06% 39 8542 0.09% 40 16986 0.18% 41 3497 0.04% 42 4445 0.05% 43 6556 0.07% 44 10714 0.11% 45 20482 0.22% 46 4391 0.05% 47 5561 0.06% 48 8082 0.08% 49 13203 0.14% 50 25238 0.27% 51 5459 0.06% 52 6944 0.07% 53 10288 0.11% 54 17461 0.18% 55 34178 0.36% 56 7124 0.07% 57 9469 0.10% 58 14368 0.15% 59 24750 0.26% 60 51003 0.54% 61 9888 0.10% 62 13167 0.14% 63 20381 0.21% 64 36306 0.38% 65 67009 0.70% 66 15591 0.16% 67 46249 0.49% 68 8888978 93.46% 9510966 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=6.69 fanout-score-rank=16 prefix-density=0.20 prefix-fanout=1.5 sequence=CTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=15 fanout-score=216.51 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.7 sequence=TTCTTCTTCTTC Started job on | Feb 10 13:44:59 Started mapping on | Feb 10 13:44:59 Finished on | Feb 10 13:45:07 Mapping speed, Million of reads per hour | 4279.93 Number of input reads | 9510966 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8903549 Uniquely mapped reads % | 93.61% Average mapped length | 66.91 Number of splices: Total | 1615589 Number of splices: Annotated (sjdb) | 1585738 Number of splices: GT/AG | 1589328 Number of splices: GC/AG | 21462 Number of splices: AT/AC | 2090 Number of splices: Non-canonical | 2709 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315795 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 222136 % of reads mapped to too many loci | 2.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 291622 291622 291622 N_multimapping 315795 315795 315795 N_noFeature 496673 4670842 4676238 N_ambiguous 82697 14779 14888 UnstrandedReadsAssigned:8324179 PositiveStrandReadsAssigned:4217928 NegativeStrandReadsAssigned:4212423 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207697 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207697-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,510,966 reads, 8,695,010 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR3207697.ke.tsv 34699 SRR3207697.se.tsv 87100 total ==> SRR3207697.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 363 31.4334 Potri.005G024800.1.v4.1 1035 936 159 28.2281 Potri.004G059700.1.v4.1 961 862 11 2.12054 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 217.79 12.7253 Potri.016G087400.1.v4.1 270 171 317 308.052 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 45.5776 4.52434 Potri.012G127500.1.v4.1 977 878 2070 391.774 ==> SRR3207697.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1363 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 113 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207697 completed mapping pipeline successfully