Starting /dee2/code/volunteer_pipeline.sh SRR3207698 current disk space = 3059089440768 free memory = 1068574376 SRR3207698 SRAfilesize 5ba455bd7368b54c390d6c03a72cf77d SRR3207698.sra SRR3207698.sra file validated SRR3207698 is single end SRR3207698 is conventional basespace SRR3207698 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207698_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.001 38.0 36.0 39.0 33.0 40.0 2 36.56625 38.0 35.0 39.0 31.0 40.0 3 36.547 38.0 35.0 39.0 31.0 40.0 4 36.4955 38.0 35.0 39.0 31.0 40.0 5 36.4105 38.0 35.0 39.0 31.0 40.0 6 36.51325 38.0 35.0 39.0 31.0 40.0 7 36.58025 38.0 35.0 39.0 31.0 40.0 8 36.092 38.0 35.0 39.0 29.0 40.0 9 35.84675 38.0 35.0 39.0 29.0 40.0 10 35.99875 38.0 35.0 39.0 29.0 40.0 11 36.35825 38.0 35.0 39.0 30.0 40.0 12 36.04525 38.0 35.0 39.0 30.0 40.0 13 36.0355 38.0 35.0 39.0 30.0 40.0 14 35.86275 38.0 35.0 39.0 29.0 40.0 15 35.91375 38.0 35.0 39.0 29.0 40.0 16 36.02675 38.0 35.0 39.0 30.0 40.0 17 36.077 38.0 35.0 39.0 30.0 40.0 18 35.78375 38.0 35.0 39.0 29.0 40.0 19 35.7605 38.0 35.0 39.0 29.0 40.0 20 35.76925 38.0 35.0 39.0 29.0 40.0 21 35.6025 38.0 35.0 39.0 28.0 40.0 22 35.826 38.0 35.0 39.0 29.0 40.0 23 35.6785 38.0 35.0 39.0 29.0 40.0 24 36.03625 38.0 35.0 39.0 30.0 40.0 25 35.5865 38.0 35.0 39.0 29.0 40.0 26 35.694 38.0 35.0 39.0 29.0 40.0 27 35.23225 38.0 34.0 39.0 28.0 40.0 28 34.95475 38.0 33.0 39.0 27.0 40.0 29 35.04125 38.0 33.0 39.0 28.0 40.0 30 34.73375 38.0 33.0 39.0 27.0 40.0 31 34.495 38.0 33.0 39.0 26.0 40.0 32 34.188 37.0 33.0 39.0 26.0 40.0 33 34.09225 37.0 33.0 39.0 25.0 40.0 34 34.12675 37.0 33.0 39.0 26.0 40.0 35 33.776 36.0 32.0 39.0 25.0 40.0 36 33.7255 37.0 33.0 39.0 25.0 40.0 37 33.4575 36.0 32.0 39.0 23.0 40.0 38 33.338 36.0 32.0 39.0 23.0 40.0 39 32.988 36.0 31.0 39.0 23.0 40.0 40 32.99125 36.0 31.0 39.0 23.0 40.0 41 32.90675 36.0 32.0 39.0 22.0 40.0 42 33.08075 36.0 32.0 39.0 23.0 40.0 43 32.9305 36.0 31.0 39.0 23.0 40.0 44 33.08625 36.0 32.0 39.0 23.0 40.0 45 32.5735 36.0 31.0 38.0 22.0 40.0 46 32.8715 36.0 32.0 39.0 23.0 40.0 47 32.535 36.0 31.0 38.0 23.0 39.0 48 32.48175 36.0 31.0 38.0 23.0 39.0 49 32.29575 35.0 31.0 38.0 22.0 39.0 50 32.359 35.0 31.0 38.0 22.0 40.0 51 31.98125 35.0 31.0 38.0 18.0 39.0 52 31.84425 35.0 31.0 38.0 18.0 39.0 53 31.14725 35.0 29.0 38.0 17.0 39.0 54 31.1985 35.0 29.0 38.0 16.0 39.0 55 31.19625 35.0 30.0 38.0 15.0 39.0 56 30.563 35.0 29.0 38.0 2.0 39.0 57 30.026 34.0 29.0 38.0 2.0 39.0 58 29.86375 34.0 28.0 37.0 2.0 39.0 59 29.66625 34.0 28.0 37.0 2.0 39.0 60 29.062 33.0 27.0 37.0 2.0 39.0 61 29.13725 34.0 28.0 37.0 2.0 39.0 62 28.53825 33.0 27.0 36.0 2.0 39.0 63 28.42225 33.0 27.0 36.0 2.0 39.0 64 28.31625 33.0 27.0 36.0 2.0 39.0 65 27.5935 33.0 25.0 36.0 2.0 38.0 66 27.7825 33.0 26.0 36.0 2.0 39.0 67 27.3685 33.0 25.0 36.0 2.0 39.0 68 27.03275 33.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 3.0 6 9.0 7 2.0 8 6.0 9 10.0 10 6.0 11 15.0 12 13.0 13 21.0 14 17.0 15 17.0 16 24.0 17 23.0 18 24.0 19 27.0 20 18.0 21 35.0 22 34.0 23 36.0 24 35.0 25 53.0 26 90.0 27 83.0 28 76.0 29 109.0 30 133.0 31 128.0 32 179.0 33 229.0 34 278.0 35 427.0 36 497.0 37 536.0 38 579.0 39 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.642049736247174 15.724692288369758 15.975885455915598 43.65737251946747 2 19.625 25.75 36.75 17.875 3 22.425 28.299999999999997 26.3 22.975 4 24.6 34.0 19.85 21.55 5 24.55 35.099999999999994 22.8 17.549999999999997 6 17.150000000000002 37.25 25.424999999999997 20.175 7 14.725 18.125 46.1 21.05 8 18.75 22.45 30.099999999999998 28.7 9 19.725 22.95 31.275 26.05 10 19.725 38.3 23.65 18.325 11 24.325 29.25 20.625 25.8 12 21.575 24.25 29.799999999999997 24.375 13 20.775 27.325 30.925000000000004 20.974999999999998 14 21.224999999999998 27.450000000000003 28.775000000000002 22.55 15 21.675 27.224999999999998 28.449999999999996 22.650000000000002 16 22.0 28.925 28.075 21.0 17 22.675 27.35 27.6 22.375 18 20.724999999999998 28.925 28.075 22.275 19 21.55 27.875 27.525 23.05 20 21.45 27.6 27.275 23.674999999999997 21 21.65 27.35 28.65 22.35 22 22.325 28.275 28.1 21.3 23 21.4 28.875 27.325 22.400000000000002 24 21.675 28.749999999999996 27.975 21.6 25 21.5 29.349999999999998 27.05 22.1 26 21.375 28.7 26.75 23.175 27 21.875 27.775 28.525 21.825 28 21.325 27.925 28.175 22.575 29 22.025 27.125 28.449999999999996 22.400000000000002 30 21.6 28.000000000000004 28.449999999999996 21.95 31 21.575 27.575 27.725 23.125 32 21.325 27.474999999999998 28.799999999999997 22.400000000000002 33 21.275 27.925 28.275 22.525000000000002 34 21.224999999999998 28.175 28.375 22.225 35 21.575 28.875 27.825 21.725 36 20.75 28.95 28.249999999999996 22.05 37 21.825 28.625 28.299999999999997 21.25 38 22.975 28.275 26.650000000000002 22.1 39 21.875 28.249999999999996 28.000000000000004 21.875 40 21.075 28.4 28.625 21.9 41 22.05 27.400000000000002 28.175 22.375 42 21.05 29.475 27.425 22.05 43 20.825 27.925 28.1 23.150000000000002 44 20.849999999999998 29.299999999999997 27.875 21.975 45 21.025 28.475 28.749999999999996 21.75 46 21.975 27.725 27.950000000000003 22.35 47 22.05 28.050000000000004 28.1 21.8 48 20.9 26.75 29.099999999999998 23.25 49 22.05 28.225 27.650000000000002 22.075 50 22.35 28.475 26.924999999999997 22.25 51 21.85 28.225 27.375 22.55 52 23.125 28.875 26.0 22.0 53 23.35 29.599999999999998 25.474999999999998 21.575 54 20.825 28.575 28.249999999999996 22.35 55 22.7 28.025 28.325 20.95 56 22.400000000000002 26.724999999999998 28.15 22.725 57 22.15 27.85 27.85 22.15 58 21.349999999999998 30.475 26.6 21.575 59 21.825 28.025 27.425 22.725 60 21.325 28.775000000000002 28.125 21.775 61 22.525000000000002 27.425 27.125 22.925 62 22.95 28.725 26.6 21.725 63 22.675 28.4 26.575 22.35 64 22.525000000000002 28.775000000000002 27.275 21.425 65 22.75 28.15 26.424999999999997 22.675 66 21.725 29.299999999999997 26.6 22.375 67 21.275 28.875 27.55 22.3 68 22.175 28.4 27.275 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.5 21 4.0 22 5.0 23 5.0 24 6.5 25 8.0 26 10.5 27 21.0 28 29.0 29 33.0 30 47.0 31 57.0 32 75.5 33 107.5 34 121.0 35 131.5 36 169.5 37 197.0 38 217.0 39 267.5 40 307.0 41 316.0 42 319.5 43 317.0 44 311.0 45 327.0 46 323.0 47 303.0 48 286.0 49 248.0 50 227.0 51 193.0 52 139.0 53 119.0 54 113.0 55 91.5 56 76.0 57 64.0 58 45.5 59 39.0 60 32.0 61 23.0 62 21.0 63 16.5 64 12.0 65 9.5 66 7.0 67 6.0 68 5.0 69 5.0 70 5.0 71 5.0 72 5.0 73 4.5 74 4.0 75 4.0 76 2.0 77 0.0 78 0.0 79 1.0 80 2.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243850 spots for SRR3207698.sra Written 243850 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra Read 243845 spots for SRR3207698.sra Written 243845 spots for SRR3207698.sra SRR ids: ['SRR3207698.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__jbv27un SRR3207698.sra spots: 4876905 blocks: [[1, 243845], [243846, 487690], [487691, 731535], [731536, 975380], [975381, 1219225], [1219226, 1463070], [1463071, 1706915], [1706916, 1950760], [1950761, 2194605], [2194606, 2438450], [2438451, 2682295], [2682296, 2926140], [2926141, 3169985], [3169986, 3413830], [3413831, 3657675], [3657676, 3901520], [3901521, 4145365], [4145366, 4389210], [4389211, 4633055], [4633056, 4876905]] SRR3207698 file size 1023704 SRR3207698 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207698 SRR3207698_1.fastq Input file: SRR3207698_1.fastq trimmed: SRR3207698-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 13:54:27 2025 >> started Mon Feb 10 13:54:30 2025 >> done (2.429s) 4876905 reads processed; of these: 13507 ( 0.28%) short reads filtered out after trimming by size control 5243 ( 0.11%) empty reads filtered out after trimming by size control 4858155 (99.62%) reads available; of these: 487444 (10.03%) trimmed reads available after processing 4370711 (89.97%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1560 0.03% 19 2511 0.05% 20 3758 0.08% 21 1196 0.02% 22 1856 0.04% 23 2793 0.06% 24 4778 0.10% 25 7740 0.16% 26 2149 0.04% 27 2695 0.06% 28 3596 0.07% 29 5440 0.11% 30 9601 0.20% 31 2381 0.05% 32 3151 0.06% 33 4090 0.08% 34 5877 0.12% 35 9211 0.19% 36 2293 0.05% 37 3115 0.06% 38 4279 0.09% 39 6433 0.13% 40 9800 0.20% 41 2448 0.05% 42 3330 0.07% 43 4879 0.10% 44 7559 0.16% 45 11700 0.24% 46 2872 0.06% 47 4072 0.08% 48 6423 0.13% 49 10872 0.22% 50 17523 0.36% 51 4328 0.09% 52 6664 0.14% 53 10019 0.21% 54 16459 0.34% 55 29506 0.61% 56 6127 0.13% 57 9092 0.19% 58 13879 0.29% 59 23106 0.48% 60 40997 0.84% 61 8598 0.18% 62 12331 0.25% 63 18962 0.39% 64 32606 0.67% 65 53083 1.09% 66 11622 0.24% 67 18084 0.37% 68 4370711 89.97% 4858155 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=25 prefix-density=0.11 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=101.79 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.5 sequence=AAGAAGAAGAAA Started job on | Feb 10 13:54:52 Started mapping on | Feb 10 13:54:52 Finished on | Feb 10 13:54:59 Mapping speed, Million of reads per hour | 2498.48 Number of input reads | 4858155 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4255819 Uniquely mapped reads % | 87.60% Average mapped length | 66.53 Number of splices: Total | 795291 Number of splices: Annotated (sjdb) | 782362 Number of splices: GT/AG | 783058 Number of splices: GC/AG | 10077 Number of splices: AT/AC | 968 Number of splices: Non-canonical | 1188 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 146954 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 429481 % of reads mapped to too many loci | 8.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455382 455382 455382 N_multimapping 146954 146954 146954 N_noFeature 209031 2194923 2243728 N_ambiguous 39671 6783 6721 UnstrandedReadsAssigned:4007117 PositiveStrandReadsAssigned:2054113 NegativeStrandReadsAssigned:2005370 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207698 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207698-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,858,155 reads, 4,442,999 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR3207698.ke.tsv 34699 SRR3207698.se.tsv 87100 total ==> SRR3207698.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 152 26.1011 Potri.005G024800.1.v4.1 1035 936 41 14.4344 Potri.004G059700.1.v4.1 961 862 7 2.67597 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 93.9749 10.8886 Potri.016G087400.1.v4.1 270 171 138 265.934 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 3.937 Potri.012G127500.1.v4.1 977 878 484 181.653 ==> SRR3207698.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 445 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 74 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207698 completed mapping pipeline successfully