Starting /dee2/code/volunteer_pipeline.sh SRR3207699 current disk space = 3059040776192 free memory = 1519251864 SRR3207699 SRAfilesize bbcaba2e1fc56bc11d5df86f224493df SRR3207699.sra SRR3207699.sra file validated SRR3207699 is single end SRR3207699 is conventional basespace SRR3207699 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207699_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.902 38.0 36.0 39.0 33.0 40.0 2 36.45525 38.0 35.0 39.0 31.0 40.0 3 36.4355 38.0 35.0 39.0 31.0 40.0 4 36.38 38.0 35.0 39.0 31.0 40.0 5 36.2845 38.0 35.0 39.0 30.0 40.0 6 36.36575 38.0 35.0 39.0 30.0 40.0 7 36.36975 38.0 35.0 39.0 30.0 40.0 8 36.074 38.0 35.0 39.0 29.0 40.0 9 35.92225 38.0 35.0 39.0 29.0 40.0 10 35.95175 38.0 35.0 39.0 29.0 40.0 11 36.255 38.0 35.0 39.0 30.0 40.0 12 36.034 38.0 35.0 39.0 29.0 40.0 13 36.00675 38.0 35.0 39.0 30.0 40.0 14 35.81825 38.0 35.0 39.0 29.0 40.0 15 35.8955 38.0 35.0 39.0 29.0 40.0 16 36.16125 38.0 35.0 39.0 30.0 40.0 17 36.0215 38.0 35.0 39.0 30.0 40.0 18 35.71725 38.0 35.0 39.0 29.0 40.0 19 35.90075 38.0 35.0 39.0 29.0 40.0 20 35.73325 38.0 35.0 39.0 29.0 40.0 21 35.42225 38.0 35.0 39.0 28.0 40.0 22 35.69025 38.0 35.0 39.0 29.0 40.0 23 35.64125 38.0 35.0 39.0 29.0 40.0 24 35.77225 38.0 35.0 39.0 29.0 40.0 25 35.6165 38.0 35.0 39.0 29.0 40.0 26 35.561 38.0 35.0 39.0 29.0 40.0 27 35.09375 38.0 33.0 39.0 28.0 40.0 28 34.84225 38.0 33.0 39.0 27.0 40.0 29 34.84625 38.0 33.0 39.0 27.0 40.0 30 34.64925 38.0 33.0 39.0 27.0 40.0 31 34.3665 38.0 33.0 39.0 26.0 40.0 32 34.2355 38.0 33.0 39.0 26.0 40.0 33 33.96175 37.0 33.0 39.0 25.0 40.0 34 33.9845 37.0 33.0 39.0 26.0 40.0 35 33.786 37.0 33.0 39.0 24.0 40.0 36 33.794 37.0 33.0 39.0 25.0 40.0 37 33.558 36.0 33.0 39.0 23.0 40.0 38 33.355 36.0 32.0 39.0 23.0 40.0 39 33.16 36.0 32.0 39.0 23.0 40.0 40 33.04325 36.0 31.0 39.0 23.0 40.0 41 32.94675 36.0 32.0 39.0 23.0 40.0 42 32.9555 36.0 31.0 39.0 23.0 40.0 43 33.04275 36.0 31.0 39.0 23.0 40.0 44 33.01475 36.0 31.0 39.0 23.0 40.0 45 32.74175 36.0 31.0 38.0 23.0 40.0 46 32.84475 36.0 32.0 39.0 23.0 40.0 47 32.433 36.0 31.0 38.0 23.0 39.0 48 32.5385 36.0 31.0 38.0 23.0 39.0 49 32.24325 35.0 31.0 38.0 21.0 39.0 50 32.22225 35.0 31.0 38.0 20.0 39.0 51 31.89525 35.0 31.0 38.0 18.0 39.0 52 31.734 35.0 30.0 38.0 18.0 39.0 53 31.0825 35.0 29.0 38.0 15.0 39.0 54 31.287 35.0 30.0 38.0 17.0 39.0 55 31.0125 35.0 30.0 38.0 12.0 39.0 56 30.51 35.0 29.0 38.0 2.0 39.0 57 30.15325 34.0 29.0 38.0 2.0 39.0 58 29.97 34.0 29.0 37.0 2.0 39.0 59 29.69075 34.0 28.0 37.0 2.0 39.0 60 29.11525 33.0 27.0 37.0 2.0 39.0 61 29.2965 34.0 28.0 37.0 2.0 39.0 62 28.638 33.0 27.0 36.0 2.0 39.0 63 28.638 33.0 27.0 36.0 2.0 39.0 64 28.32875 33.0 27.0 36.0 2.0 39.0 65 27.72 33.0 25.0 36.0 2.0 38.0 66 27.81525 33.0 26.0 36.0 2.0 39.0 67 27.47425 33.0 25.0 36.0 2.0 38.0 68 27.1755 33.0 24.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 3.0 5 2.0 6 3.0 7 6.0 8 4.0 9 9.0 10 13.0 11 15.0 12 14.0 13 21.0 14 19.0 15 17.0 16 21.0 17 13.0 18 23.0 19 21.0 20 24.0 21 23.0 22 29.0 23 44.0 24 60.0 25 51.0 26 61.0 27 83.0 28 83.0 29 105.0 30 135.0 31 131.0 32 190.0 33 201.0 34 321.0 35 362.0 36 514.0 37 577.0 38 584.0 39 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.47729566094854 16.347124117053482 18.66801210898083 42.50756811301715 2 19.825 26.375 35.699999999999996 18.099999999999998 3 22.825 27.474999999999998 28.725 20.974999999999998 4 24.075 34.275 20.424999999999997 21.224999999999998 5 23.925 35.575 23.9 16.6 6 17.549999999999997 38.45 24.125 19.875 7 16.05 18.075 44.725 21.15 8 19.775000000000002 22.650000000000002 29.7 27.875 9 20.1 21.85 32.5 25.55 10 19.325 39.574999999999996 24.224999999999998 16.875 11 23.5 29.45 22.175 24.875 12 20.549999999999997 23.9 29.9 25.650000000000002 13 18.475 28.95 31.05 21.525 14 20.150000000000002 28.725 30.95 20.175 15 20.525 27.625 28.975 22.875 16 22.1 28.249999999999996 27.625 22.025 17 23.625 27.625 27.975 20.775 18 22.900000000000002 28.000000000000004 26.525 22.575 19 21.975 28.349999999999998 27.575 22.1 20 21.475 29.225 28.1 21.2 21 21.725 28.975 27.35 21.95 22 20.75 29.975 28.425 20.849999999999998 23 21.349999999999998 28.599999999999998 28.975 21.075 24 21.725 28.675 27.3 22.3 25 21.05 29.375 28.125 21.45 26 21.55 28.475 28.549999999999997 21.425 27 20.0 29.549999999999997 28.175 22.275 28 21.45 28.449999999999996 28.375 21.725 29 22.425 27.55 27.800000000000004 22.225 30 20.8 28.725 27.900000000000002 22.575 31 21.6 28.65 27.750000000000004 22.0 32 22.275 27.525 27.875 22.325 33 20.625 28.599999999999998 28.849999999999998 21.925 34 20.95 27.85 29.2 22.0 35 22.2 29.425 27.05 21.325 36 21.425 28.425 28.549999999999997 21.6 37 22.575 28.4 27.325 21.7 38 21.775 28.825 27.150000000000002 22.25 39 22.175 28.249999999999996 27.35 22.225 40 22.775000000000002 27.775 27.250000000000004 22.2 41 22.475 28.475 27.525 21.525 42 19.925 29.125 28.975 21.975 43 22.525000000000002 28.125 27.200000000000003 22.15 44 22.1 28.7 27.200000000000003 22.0 45 20.8 28.65 27.525 23.025000000000002 46 21.525 27.425 29.299999999999997 21.75 47 22.0 28.375 27.800000000000004 21.825 48 22.325 28.775000000000002 27.375 21.525 49 21.575 28.749999999999996 27.725 21.95 50 21.975 29.725 26.875 21.425 51 21.6 29.25 27.6 21.55 52 22.925 29.049999999999997 26.325 21.7 53 23.0 27.900000000000002 27.400000000000002 21.7 54 20.424999999999997 28.65 29.975 20.95 55 21.3 28.349999999999998 28.449999999999996 21.9 56 21.625 27.950000000000003 29.025000000000002 21.4 57 21.175 28.7 28.000000000000004 22.125 58 22.025 28.075 28.249999999999996 21.65 59 22.175 27.975 27.700000000000003 22.15 60 21.525 29.975 27.3 21.2 61 22.675 27.150000000000002 27.425 22.75 62 23.525 28.95 26.174999999999997 21.349999999999998 63 21.525 29.4 27.1 21.975 64 22.2 28.9 27.150000000000002 21.75 65 21.775 28.975 27.425 21.825 66 21.5 28.9 27.85 21.75 67 22.125 27.85 28.175 21.85 68 22.95 28.625 26.650000000000002 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 2.0 19 3.0 20 3.0 21 3.5 22 4.0 23 4.0 24 8.5 25 13.0 26 14.0 27 21.0 28 27.0 29 35.0 30 54.0 31 65.0 32 69.5 33 97.0 34 120.0 35 143.5 36 189.5 37 212.0 38 223.5 39 248.5 40 285.0 41 308.0 42 327.5 43 363.0 44 379.0 45 381.0 46 348.0 47 313.0 48 284.0 49 224.5 50 194.0 51 184.5 52 143.0 53 111.0 54 100.0 55 70.5 56 52.0 57 47.0 58 36.0 59 30.0 60 25.5 61 17.5 62 14.0 63 10.5 64 7.0 65 6.0 66 5.0 67 2.5 68 2.0 69 4.0 70 4.0 71 4.5 72 5.0 73 3.0 74 1.0 75 1.0 76 1.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264867 spots for SRR3207699.sra Written 264867 spots for SRR3207699.sra Read 264883 spots for SRR3207699.sra Written 264883 spots for SRR3207699.sra SRR ids: ['SRR3207699.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uf54fhna SRR3207699.sra spots: 5297356 blocks: [[1, 264867], [264868, 529734], [529735, 794601], [794602, 1059468], [1059469, 1324335], [1324336, 1589202], [1589203, 1854069], [1854070, 2118936], [2118937, 2383803], [2383804, 2648670], [2648671, 2913537], [2913538, 3178404], [3178405, 3443271], [3443272, 3708138], [3708139, 3973005], [3973006, 4237872], [4237873, 4502739], [4502740, 4767606], [4767607, 5032473], [5032474, 5297356]] SRR3207699 file size 1112061 SRR3207699 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207699 SRR3207699_1.fastq Input file: SRR3207699_1.fastq trimmed: SRR3207699-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:36:05 2025 >> started Mon Feb 10 14:36:07 2025 >> done (2.547s) 5297356 reads processed; of these: 13139 ( 0.25%) short reads filtered out after trimming by size control 11424 ( 0.22%) empty reads filtered out after trimming by size control 5272793 (99.54%) reads available; of these: 479612 ( 9.10%) trimmed reads available after processing 4793181 (90.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1511 0.03% 19 2363 0.04% 20 3403 0.06% 21 1204 0.02% 22 1759 0.03% 23 2601 0.05% 24 4338 0.08% 25 7251 0.14% 26 1960 0.04% 27 2554 0.05% 28 3339 0.06% 29 5308 0.10% 30 8867 0.17% 31 2145 0.04% 32 2911 0.06% 33 3895 0.07% 34 5766 0.11% 35 8706 0.17% 36 2176 0.04% 37 2918 0.06% 38 4101 0.08% 39 6173 0.12% 40 9063 0.17% 41 2177 0.04% 42 3224 0.06% 43 4425 0.08% 44 7228 0.14% 45 11036 0.21% 46 2764 0.05% 47 3887 0.07% 48 6192 0.12% 49 10658 0.20% 50 16923 0.32% 51 4222 0.08% 52 6442 0.12% 53 9819 0.19% 54 16625 0.32% 55 29287 0.56% 56 6044 0.11% 57 9077 0.17% 58 13619 0.26% 59 23076 0.44% 60 41139 0.78% 61 8463 0.16% 62 12530 0.24% 63 19236 0.36% 64 33301 0.63% 65 54016 1.02% 66 11542 0.22% 67 18348 0.35% 68 4793181 90.90% 5272793 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=30 prefix-density=0.03 prefix-fanout=1.9 sequence=TCCTATGCTATTGGTGTACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=178.86 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=20.1 sequence=TTCTTCTTCTTC Started job on | Feb 10 14:36:26 Started mapping on | Feb 10 14:36:26 Finished on | Feb 10 14:36:32 Mapping speed, Million of reads per hour | 3163.68 Number of input reads | 5272793 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4910066 Uniquely mapped reads % | 93.12% Average mapped length | 66.62 Number of splices: Total | 940453 Number of splices: Annotated (sjdb) | 925306 Number of splices: GT/AG | 925973 Number of splices: GC/AG | 12145 Number of splices: AT/AC | 1179 Number of splices: Non-canonical | 1156 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167947 % of reads mapped to multiple loci | 3.19% Number of reads mapped to too many loci | 173654 % of reads mapped to too many loci | 3.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 194780 194780 194780 N_multimapping 167947 167947 167947 N_noFeature 241404 2533269 2589217 N_ambiguous 44928 8063 7936 UnstrandedReadsAssigned:4623734 PositiveStrandReadsAssigned:2368734 NegativeStrandReadsAssigned:2312913 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207699 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207699-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,272,793 reads, 4,848,999 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR3207699.ke.tsv 34699 SRR3207699.se.tsv 87100 total ==> SRR3207699.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 193 31.3442 Potri.005G024800.1.v4.1 1035 936 41 13.6516 Potri.004G059700.1.v4.1 961 862 9 3.25395 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 121.643 13.3301 Potri.016G087400.1.v4.1 270 171 163 297.075 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 3.72349 Potri.012G127500.1.v4.1 977 878 604 214.396 ==> SRR3207699.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 636 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 90 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207699 completed mapping pipeline successfully