Starting /dee2/code/volunteer_pipeline.sh SRR3207700 current disk space = 3059036184576 free memory = 1372144080 SRR3207700 SRAfilesize ca450704d22d295da177bb99d880b630 SRR3207700.sra SRR3207700.sra file validated SRR3207700 is single end SRR3207700 is conventional basespace SRR3207700 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207700_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.87775 38.0 36.0 39.0 33.0 40.0 2 36.5305 38.0 36.0 39.0 31.0 40.0 3 36.37825 38.0 35.0 39.0 30.0 40.0 4 36.2905 38.0 35.0 39.0 30.0 40.0 5 36.25825 38.0 35.0 39.0 30.0 40.0 6 36.35725 38.0 35.0 39.0 30.0 40.0 7 36.34975 38.0 35.0 39.0 30.0 40.0 8 36.0895 38.0 35.0 39.0 29.0 40.0 9 35.9125 38.0 35.0 39.0 29.0 40.0 10 35.908 38.0 35.0 39.0 29.0 40.0 11 36.253 38.0 35.0 39.0 30.0 40.0 12 35.9835 38.0 35.0 39.0 29.0 40.0 13 35.96675 38.0 35.0 39.0 29.0 40.0 14 35.7875 38.0 35.0 39.0 29.0 40.0 15 35.8725 38.0 35.0 39.0 29.0 40.0 16 36.09075 38.0 35.0 39.0 30.0 40.0 17 36.151 38.0 35.0 39.0 30.0 40.0 18 35.759 38.0 35.0 39.0 29.0 40.0 19 35.88175 38.0 35.0 39.0 29.0 40.0 20 35.894 38.0 35.0 39.0 29.0 40.0 21 35.5395 38.0 35.0 39.0 29.0 40.0 22 35.746 38.0 35.0 39.0 29.0 40.0 23 35.734 38.0 35.0 39.0 29.0 40.0 24 35.94375 38.0 35.0 39.0 30.0 40.0 25 35.61975 38.0 35.0 39.0 29.0 40.0 26 35.53775 38.0 35.0 39.0 29.0 40.0 27 35.195 38.0 33.0 39.0 28.0 40.0 28 34.80825 38.0 33.0 39.0 27.0 40.0 29 34.743 38.0 33.0 39.0 27.0 40.0 30 34.65625 38.0 33.0 39.0 27.0 40.0 31 34.46825 38.0 33.0 39.0 26.0 40.0 32 34.20625 37.0 33.0 39.0 26.0 40.0 33 34.0505 37.0 33.0 39.0 25.0 40.0 34 33.962 37.0 33.0 39.0 25.0 40.0 35 33.69525 37.0 32.0 39.0 23.0 40.0 36 33.50925 36.0 32.0 39.0 23.0 40.0 37 33.375 36.0 32.0 39.0 23.0 40.0 38 33.15575 36.0 31.0 39.0 23.0 40.0 39 32.90825 36.0 31.0 39.0 23.0 40.0 40 32.98225 36.0 31.0 39.0 23.0 40.0 41 32.87575 36.0 31.0 39.0 23.0 40.0 42 32.96225 36.0 31.0 39.0 23.0 40.0 43 32.92275 36.0 31.0 38.0 23.0 40.0 44 33.055 36.0 32.0 38.0 23.0 40.0 45 32.68125 36.0 31.0 38.0 23.0 40.0 46 32.7715 36.0 31.0 38.0 23.0 40.0 47 32.5355 36.0 31.0 38.0 23.0 39.0 48 32.4615 36.0 31.0 38.0 22.0 39.0 49 32.19775 35.0 31.0 38.0 21.0 39.0 50 32.4705 35.0 31.0 38.0 23.0 39.0 51 31.984 35.0 31.0 38.0 19.0 39.0 52 31.80475 35.0 30.0 38.0 18.0 39.0 53 31.184 35.0 29.0 38.0 17.0 39.0 54 31.2735 35.0 30.0 38.0 17.0 39.0 55 31.13675 35.0 30.0 38.0 17.0 39.0 56 30.64225 35.0 29.0 38.0 2.0 39.0 57 29.9995 34.0 29.0 37.0 2.0 39.0 58 29.9195 34.0 29.0 37.0 2.0 39.0 59 29.67025 33.0 28.0 37.0 2.0 39.0 60 29.16725 33.0 27.0 36.0 2.0 39.0 61 29.24075 34.0 28.0 37.0 2.0 39.0 62 28.61975 33.0 27.0 36.0 2.0 39.0 63 28.747 33.0 27.0 37.0 2.0 39.0 64 28.47675 33.0 27.0 36.0 2.0 39.0 65 27.69875 33.0 25.0 36.0 2.0 38.0 66 27.951 33.0 26.0 36.0 2.0 39.0 67 27.62375 33.0 25.0 36.0 2.0 39.0 68 27.38275 33.0 25.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 0.0 5 3.0 6 5.0 7 2.0 8 3.0 9 11.0 10 10.0 11 20.0 12 18.0 13 16.0 14 17.0 15 16.0 16 9.0 17 21.0 18 21.0 19 33.0 20 17.0 21 34.0 22 35.0 23 42.0 24 43.0 25 57.0 26 72.0 27 93.0 28 82.0 29 123.0 30 109.0 31 130.0 32 175.0 33 247.0 34 274.0 35 382.0 36 516.0 37 574.0 38 575.0 39 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.132341820015125 15.628938744643307 18.704310562137636 40.53440887320393 2 21.175 25.424999999999997 35.75 17.65 3 22.425 28.050000000000004 27.325 22.2 4 22.35 33.725 22.575 21.349999999999998 5 24.65 36.8 22.25 16.3 6 18.425 36.925000000000004 24.95 19.7 7 16.575 16.975 45.375 21.075 8 19.35 23.150000000000002 30.275000000000002 27.224999999999998 9 19.825 22.525000000000002 31.15 26.5 10 19.900000000000002 39.35 23.125 17.625 11 23.724999999999998 30.25 21.375 24.65 12 20.9 25.75 28.249999999999996 25.1 13 19.45 27.675 31.924999999999997 20.95 14 20.674999999999997 27.125 31.225 20.974999999999998 15 22.175 26.825 27.125 23.875 16 21.4 28.175 27.85 22.575 17 21.325 28.925 27.85 21.9 18 19.875 28.999999999999996 29.175 21.95 19 22.400000000000002 27.400000000000002 27.725 22.475 20 21.075 28.425 26.8 23.7 21 21.425 28.075 27.05 23.45 22 21.775 28.999999999999996 27.175 22.05 23 20.875 29.625 27.650000000000002 21.85 24 20.25 29.5 28.95 21.3 25 21.75 28.075 27.85 22.325 26 20.849999999999998 29.575000000000003 28.475 21.099999999999998 27 22.525000000000002 28.9 27.075 21.5 28 22.425 29.275000000000002 26.575 21.725 29 21.15 28.375 29.15 21.325 30 21.525 28.275 28.175 22.025 31 21.15 28.225 27.025 23.599999999999998 32 21.05 30.925000000000004 27.500000000000004 20.525 33 20.849999999999998 29.125 28.075 21.95 34 21.2 28.499999999999996 27.85 22.45 35 20.525 30.45 28.4 20.625 36 21.0 30.175 28.7 20.125 37 20.599999999999998 28.849999999999998 28.475 22.075 38 22.95 28.725 27.175 21.15 39 22.35 28.1 27.750000000000004 21.8 40 20.0 28.799999999999997 29.2 22.0 41 22.475 29.75 28.475 19.3 42 21.975 28.425 28.799999999999997 20.8 43 20.925 29.75 27.85 21.475 44 22.55 27.450000000000003 28.425 21.575 45 21.375 27.85 28.825 21.95 46 21.099999999999998 28.275 29.675 20.95 47 22.675 28.199999999999996 27.875 21.25 48 21.05 27.700000000000003 28.225 23.025000000000002 49 21.75 27.85 27.325 23.075000000000003 50 22.275 29.675 27.075 20.974999999999998 51 20.7 28.999999999999996 28.625 21.675 52 21.6 28.925 28.275 21.2 53 22.125 29.15 27.425 21.3 54 21.3 28.475 28.249999999999996 21.975 55 22.1 29.475 28.4 20.025000000000002 56 22.05 28.325 28.475 21.15 57 22.3 28.95 27.950000000000003 20.8 58 21.4 28.249999999999996 28.575 21.775 59 22.0 28.4 28.499999999999996 21.099999999999998 60 21.224999999999998 27.250000000000004 29.125 22.400000000000002 61 20.625 28.349999999999998 28.349999999999998 22.675 62 21.3 28.275 28.549999999999997 21.875 63 21.2 28.275 29.5 21.025 64 21.275 29.225 27.500000000000004 22.0 65 21.224999999999998 28.499999999999996 28.325 21.95 66 22.425 27.725 28.9 20.95 67 22.0 28.7 27.425 21.875 68 21.5 29.099999999999998 27.325 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 1.0 19 2.0 20 2.0 21 4.5 22 7.0 23 6.0 24 10.5 25 16.0 26 17.5 27 19.0 28 19.0 29 27.5 30 50.0 31 64.0 32 71.0 33 97.0 34 116.0 35 144.5 36 178.0 37 183.0 38 219.0 39 267.5 40 307.0 41 334.0 42 353.0 43 375.0 44 378.0 45 371.5 46 348.5 47 332.0 48 292.5 49 227.0 50 201.0 51 168.0 52 131.0 53 127.0 54 104.0 55 65.0 56 49.0 57 46.5 58 30.5 59 17.0 60 18.0 61 15.0 62 11.0 63 8.0 64 6.0 65 4.0 66 1.0 67 0.5 68 0.5 69 1.0 70 1.5 71 3.0 72 4.0 73 2.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295643 spots for SRR3207700.sra Written 295643 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra Read 295633 spots for SRR3207700.sra Written 295633 spots for SRR3207700.sra SRR ids: ['SRR3207700.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ebxhvhq3 SRR3207700.sra spots: 5912670 blocks: [[1, 295633], [295634, 591266], [591267, 886899], [886900, 1182532], [1182533, 1478165], [1478166, 1773798], [1773799, 2069431], [2069432, 2365064], [2365065, 2660697], [2660698, 2956330], [2956331, 3251963], [3251964, 3547596], [3547597, 3843229], [3843230, 4138862], [4138863, 4434495], [4434496, 4730128], [4730129, 5025761], [5025762, 5321394], [5321395, 5617027], [5617028, 5912670]] SRR3207700 file size 1241360 SRR3207700 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207700 SRR3207700_1.fastq Input file: SRR3207700_1.fastq trimmed: SRR3207700-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:44:28 2025 >> started Mon Feb 10 14:44:31 2025 >> done (2.936s) 5912670 reads processed; of these: 14710 ( 0.25%) short reads filtered out after trimming by size control 8880 ( 0.15%) empty reads filtered out after trimming by size control 5889080 (99.60%) reads available; of these: 522163 ( 8.87%) trimmed reads available after processing 5366917 (91.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1742 0.03% 19 2636 0.04% 20 3868 0.07% 21 1273 0.02% 22 2030 0.03% 23 2845 0.05% 24 4861 0.08% 25 7983 0.14% 26 2210 0.04% 27 2823 0.05% 28 3766 0.06% 29 5678 0.10% 30 9703 0.16% 31 2366 0.04% 32 3107 0.05% 33 4283 0.07% 34 6244 0.11% 35 9479 0.16% 36 2290 0.04% 37 3136 0.05% 38 4355 0.07% 39 6595 0.11% 40 9590 0.16% 41 2346 0.04% 42 3516 0.06% 43 4935 0.08% 44 7809 0.13% 45 12051 0.20% 46 2960 0.05% 47 4206 0.07% 48 6679 0.11% 49 11478 0.19% 50 18326 0.31% 51 4477 0.08% 52 6871 0.12% 53 10686 0.18% 54 17644 0.30% 55 32269 0.55% 56 6668 0.11% 57 9688 0.16% 58 14903 0.25% 59 25233 0.43% 60 45367 0.77% 61 9123 0.15% 62 13372 0.23% 63 20823 0.35% 64 36087 0.61% 65 59120 1.00% 66 12613 0.21% 67 20050 0.34% 68 5366917 91.13% 5889080 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=37 prefix-density=0.03 prefix-fanout=1.9 sequence=CCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=15 fanout-score=210.06 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=22.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 14:44:47 Started mapping on | Feb 10 14:44:47 Finished on | Feb 10 14:44:53 Mapping speed, Million of reads per hour | 3533.45 Number of input reads | 5889080 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5584521 Uniquely mapped reads % | 94.83% Average mapped length | 66.61 Number of splices: Total | 1065887 Number of splices: Annotated (sjdb) | 1048775 Number of splices: GT/AG | 1049248 Number of splices: GC/AG | 13936 Number of splices: AT/AC | 1311 Number of splices: Non-canonical | 1392 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 188318 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 92015 % of reads mapped to too many loci | 1.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 116241 116241 116241 N_multimapping 188318 188318 188318 N_noFeature 277059 2885679 2943437 N_ambiguous 50089 8769 8907 UnstrandedReadsAssigned:5257373 PositiveStrandReadsAssigned:2690073 NegativeStrandReadsAssigned:2632177 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207700 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207700-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,889,080 reads, 5,421,389 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR3207700.ke.tsv 34699 SRR3207700.se.tsv 87100 total ==> SRR3207700.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 198 28.7387 Potri.005G024800.1.v4.1 1035 936 43 12.7959 Potri.004G059700.1.v4.1 961 862 6 1.93875 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 132.366 12.9635 Potri.016G087400.1.v4.1 270 171 181 294.822 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 29 4.82525 Potri.012G127500.1.v4.1 977 878 928 294.395 ==> SRR3207700.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 641 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 84 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207700 completed mapping pipeline successfully