Starting /dee2/code/volunteer_pipeline.sh SRR3207701 current disk space = 3059105468416 free memory = 1383927004 SRR3207701 SRAfilesize 59dc2d9405d1c8c0078499ded9d8b3ac SRR3207701.sra SRR3207701.sra file validated SRR3207701 is single end SRR3207701 is conventional basespace SRR3207701 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207701_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69425 37.0 30.0 39.0 19.0 40.0 2 33.47075 37.0 31.0 40.0 23.0 40.0 3 33.2735 36.0 30.0 39.0 22.0 40.0 4 33.4795 37.0 31.0 39.0 22.0 40.0 5 33.81425 38.0 31.0 40.0 23.0 40.0 6 34.7795 38.0 32.0 40.0 25.0 40.0 7 35.0175 38.0 33.0 40.0 25.0 40.0 8 34.823 38.0 32.0 40.0 25.0 40.0 9 35.11575 38.0 33.0 40.0 26.0 40.0 10 35.17275 38.0 33.0 40.0 27.0 40.0 11 36.1035 38.0 34.0 40.0 31.0 40.0 12 36.221 38.0 34.0 40.0 31.0 40.0 13 36.19375 38.0 34.0 40.0 31.0 40.0 14 36.25425 38.0 34.0 40.0 31.0 40.0 15 36.3715 38.0 35.0 40.0 31.0 40.0 16 36.4885 38.0 35.0 40.0 31.0 40.0 17 36.47 38.0 35.0 40.0 31.0 40.0 18 36.532 39.0 35.0 40.0 31.0 40.0 19 36.584 39.0 35.0 40.0 31.0 40.0 20 36.543 38.0 35.0 40.0 31.0 40.0 21 36.498 38.0 35.0 40.0 31.0 40.0 22 36.54275 39.0 35.0 40.0 31.0 40.0 23 36.48475 38.0 35.0 40.0 31.0 40.0 24 36.5375 38.0 35.0 40.0 31.0 40.0 25 36.54925 38.0 35.0 40.0 31.0 40.0 26 36.55875 39.0 35.0 40.0 31.0 40.0 27 36.965 39.0 36.0 40.0 31.0 40.0 28 36.8885 39.0 36.0 40.0 31.0 40.0 29 36.78725 39.0 36.0 40.0 31.0 40.0 30 36.74225 39.0 36.0 40.0 31.0 40.0 31 36.869 39.0 36.0 40.0 31.0 40.0 32 36.8445 39.0 36.0 40.0 31.0 40.0 33 37.01 39.0 36.0 40.0 31.0 40.0 34 36.9505 39.0 36.0 40.0 31.0 40.0 35 37.01325 39.0 36.0 40.0 31.0 40.0 36 37.1685 39.0 37.0 40.0 33.0 40.0 37 37.1075 39.0 37.0 40.0 32.0 40.0 38 37.01075 39.0 36.0 40.0 31.0 40.0 39 37.0125 39.0 37.0 40.0 32.0 40.0 40 36.92275 39.0 36.0 40.0 31.0 40.0 41 36.8455 39.0 36.0 40.0 31.0 40.0 42 36.79875 39.0 36.0 40.0 31.0 40.0 43 36.705 39.0 36.0 40.0 31.0 40.0 44 36.63175 39.0 36.0 40.0 31.0 40.0 45 36.632 39.0 36.0 40.0 31.0 40.0 46 36.63725 39.0 36.0 40.0 31.0 40.0 47 36.58825 39.0 36.0 40.0 31.0 40.0 48 36.487 39.0 36.0 40.0 31.0 40.0 49 36.39125 39.0 35.0 40.0 31.0 40.0 50 36.3825 39.0 36.0 40.0 31.0 40.0 51 36.2775 39.0 36.0 40.0 31.0 40.0 52 36.11825 39.0 35.0 40.0 31.0 40.0 53 35.989 39.0 35.0 40.0 30.0 40.0 54 36.02 38.0 35.0 40.0 31.0 40.0 55 35.89075 38.0 35.0 40.0 30.0 40.0 56 35.73175 38.0 35.0 40.0 30.0 40.0 57 35.63575 38.0 35.0 40.0 30.0 40.0 58 35.64475 38.0 35.0 40.0 30.0 40.0 59 35.438 38.0 35.0 40.0 29.0 40.0 60 35.32925 38.0 35.0 40.0 29.0 40.0 61 35.1875 38.0 35.0 39.0 29.0 40.0 62 34.82025 38.0 34.0 39.0 28.0 40.0 63 34.916 38.0 34.0 39.0 28.0 40.0 64 34.69425 38.0 33.0 39.0 28.0 40.0 65 34.35 38.0 33.0 39.0 27.0 40.0 66 34.233 38.0 33.0 39.0 27.0 40.0 67 33.87925 37.0 33.0 39.0 26.0 40.0 68 32.75875 36.0 31.0 39.0 23.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 3.0 11 3.0 12 2.0 13 1.0 14 5.0 15 4.0 16 2.0 17 13.0 18 4.0 19 8.0 20 7.0 21 9.0 22 17.0 23 17.0 24 22.0 25 33.0 26 37.0 27 39.0 28 65.0 29 77.0 30 77.0 31 82.0 32 92.0 33 134.0 34 169.0 35 283.0 36 500.0 37 651.0 38 775.0 39 844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.29235880398671 13.902376693074366 31.765908510094558 42.039355992844364 2 18.9 25.15 37.15 18.8 3 22.55 30.15 26.05 21.25 4 24.375 33.45 20.549999999999997 21.625 5 24.775 34.55 23.35 17.325 6 19.375 35.475 25.1 20.05 7 16.85 16.875 44.324999999999996 21.95 8 19.5 24.175 29.175 27.150000000000002 9 20.4 23.225 30.025000000000002 26.35 10 21.0 38.6 23.625 16.775000000000002 11 25.1 27.825 21.25 25.825 12 21.375 24.425 28.525 25.674999999999997 13 18.975 28.599999999999998 31.225 21.2 14 20.849999999999998 28.375 28.249999999999996 22.525000000000002 15 20.849999999999998 27.175 28.799999999999997 23.175 16 22.375 29.025000000000002 26.825 21.775 17 21.65 28.449999999999996 28.050000000000004 21.85 18 22.175 27.925 27.474999999999998 22.425 19 21.15 28.249999999999996 27.55 23.05 20 22.0 28.125 27.950000000000003 21.925 21 21.7 27.400000000000002 28.775000000000002 22.125 22 21.675 28.249999999999996 27.325 22.75 23 21.0 29.125 28.349999999999998 21.525 24 21.775 29.599999999999998 27.6 21.025 25 21.575 27.625 26.8 24.0 26 20.9 28.825 27.975 22.3 27 21.349999999999998 27.525 28.675 22.45 28 21.575 26.8 29.225 22.400000000000002 29 21.525 28.999999999999996 27.025 22.45 30 23.525 26.650000000000002 28.65 21.175 31 21.224999999999998 28.325 28.675 21.775 32 21.4 28.925 27.55 22.125 33 22.175 27.875 27.55 22.400000000000002 34 22.275 27.900000000000002 28.425 21.4 35 22.1 27.175 28.599999999999998 22.125 36 21.85 27.975 27.725 22.45 37 23.175 27.825 27.725 21.275 38 20.775 29.45 27.650000000000002 22.125 39 21.65 28.299999999999997 28.425 21.625 40 22.95 27.625 27.3 22.125 41 22.175 28.9 25.974999999999998 22.95 42 23.474999999999998 28.799999999999997 26.724999999999998 21.0 43 22.650000000000002 28.125 27.6 21.625 44 21.9 28.025 28.249999999999996 21.825 45 21.45 28.175 27.925 22.45 46 22.5 27.35 28.1 22.05 47 21.45 30.099999999999998 27.05 21.4 48 21.95 27.925 28.275 21.85 49 21.475 28.9 28.599999999999998 21.025 50 21.575 27.800000000000004 28.975 21.65 51 22.625 28.4 27.650000000000002 21.325 52 22.625 28.025 27.325 22.025 53 21.925 28.15 27.750000000000004 22.175 54 21.3 27.675 27.975 23.05 55 21.775 27.35 27.725 23.150000000000002 56 21.825 28.050000000000004 28.125 22.0 57 21.4 28.725 28.325 21.55 58 21.8 28.825 27.825 21.55 59 20.95 27.700000000000003 28.749999999999996 22.6 60 22.025 26.125 29.775000000000002 22.075 61 22.8 26.875 28.65 21.675 62 21.725 27.675 29.2 21.4 63 22.225 27.525 27.3 22.95 64 21.6 27.375 28.999999999999996 22.025 65 21.325 29.349999999999998 27.875 21.45 66 22.5 28.575 27.125 21.8 67 21.9 27.975 27.6 22.525000000000002 68 21.625 27.950000000000003 27.700000000000003 22.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 4.0 21 4.5 22 3.0 23 5.5 24 11.5 25 15.0 26 21.0 27 26.0 28 25.0 29 32.5 30 47.5 31 55.0 32 69.5 33 98.0 34 112.0 35 125.0 36 172.0 37 206.0 38 233.0 39 270.5 40 281.5 41 282.0 42 313.0 43 343.0 44 342.0 45 326.0 46 322.0 47 334.0 48 307.5 49 249.0 50 217.0 51 180.5 52 137.0 53 130.0 54 125.0 55 94.0 56 68.0 57 57.0 58 38.0 59 30.0 60 26.0 61 19.0 62 16.0 63 14.0 64 11.0 65 9.0 66 8.0 67 7.5 68 6.0 69 5.0 70 3.0 71 2.0 72 3.0 73 3.0 74 2.5 75 2.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77307110438728 98.925 2 0.10085728693898136 0.2 3 0.07564296520423601 0.22499999999999998 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAA 22 0.5499999999999999 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.625 0.0 0.0 0.0 0.0 2 0.625 0.0 0.0 0.0 0.0 3 0.625 0.0 0.0 0.0 0.0 4 0.625 0.0 0.0 0.0 0.0 5 0.625 0.0 0.0 0.0 0.0 6 0.625 0.0 0.0 0.0 0.0 7 0.625 0.0 0.0 0.0 0.0 8 0.625 0.0 0.0 0.0 0.0 9 0.625 0.0 0.0 0.0 0.0 10 0.625 0.0 0.0 0.0 0.0 11 0.625 0.0 0.0 0.0 0.0 12 0.625 0.0 0.0 0.0 0.0 13 0.65 0.0 0.0 0.0 0.0 14 0.65 0.0 0.0 0.0 0.0 15 0.65 0.0 0.0 0.0 0.0 16 0.65 0.0 0.0 0.0 0.0 17 0.65 0.0 0.0 0.0 0.0 18 0.65 0.0 0.0 0.0 0.0 19 0.65 0.0 0.0 0.0 0.0 20 0.65 0.0 0.0 0.0 0.0 21 0.65 0.0 0.0 0.0 0.0 22 0.65 0.0 0.0 0.0 0.0 23 0.65 0.0 0.0 0.0 0.0 24 0.65 0.0 0.0 0.0 0.0 25 0.65 0.0 0.0 0.0 0.0 26 0.65 0.0 0.0 0.0 0.0 27 0.65 0.0 0.0 0.0 0.0 28 0.65 0.0 0.0 0.0 0.0 29 0.65 0.0 0.0 0.0 0.0 30 0.65 0.0 0.0 0.0 0.0 31 0.65 0.0 0.0 0.0 0.0 32 0.65 0.0 0.0 0.0 0.0 33 0.65 0.0 0.0 0.0 0.0 34 0.65 0.0 0.0 0.0 0.0 35 0.65 0.0 0.0 0.0 0.0 36 0.65 0.0 0.0 0.0 0.0 37 0.65 0.0 0.0 0.0 0.0 38 0.65 0.0 0.0 0.0 0.0 39 0.65 0.0 0.0 0.0 0.0 40 0.65 0.0 0.0 0.0 0.0 41 0.65 0.0 0.0 0.0 0.0 42 0.65 0.0 0.0 0.0 0.0 43 0.65 0.0 0.0 0.0 0.0 44 0.65 0.0 0.0 0.0 0.0 45 0.65 0.0 0.0 0.0 0.0 46 0.65 0.0 0.0 0.0 0.0 47 0.65 0.0 0.0 0.0 0.0 48 0.65 0.0 0.0 0.0 0.0 49 0.65 0.0 0.0 0.0 0.0 50 0.65 0.0 0.0 0.0 0.0 51 0.65 0.0 0.0 0.0 0.0 52 0.65 0.0 0.0 0.0 0.0 53 0.65 0.0 0.0 0.0 0.0 54 0.65 0.0 0.0 0.0 0.0 55 0.65 0.0 0.0 0.0 0.0 56 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397424 spots for SRR3207701.sra Written 397424 spots for SRR3207701.sra Read 397432 spots for SRR3207701.sra Written 397432 spots for SRR3207701.sra SRR ids: ['SRR3207701.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ngdf38a1 SRR3207701.sra spots: 7948488 blocks: [[1, 397424], [397425, 794848], [794849, 1192272], [1192273, 1589696], [1589697, 1987120], [1987121, 2384544], [2384545, 2781968], [2781969, 3179392], [3179393, 3576816], [3576817, 3974240], [3974241, 4371664], [4371665, 4769088], [4769089, 5166512], [5166513, 5563936], [5563937, 5961360], [5961361, 6358784], [6358785, 6756208], [6756209, 7153632], [7153633, 7551056], [7551057, 7948488]] SRR3207701 file size 1661470 SRR3207701 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207701 SRR3207701_1.fastq Input file: SRR3207701_1.fastq trimmed: SRR3207701-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:01:12 2025 >> started Mon Feb 10 15:01:16 2025 >> done (3.722s) 7948488 reads processed; of these: 44800 ( 0.56%) short reads filtered out after trimming by size control 110398 ( 1.39%) empty reads filtered out after trimming by size control 7793290 (98.05%) reads available; of these: 575944 ( 7.39%) trimmed reads available after processing 7217346 (92.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1908 0.02% 19 3417 0.04% 20 7502 0.10% 21 1616 0.02% 22 2154 0.03% 23 3038 0.04% 24 5024 0.06% 25 10315 0.13% 26 2655 0.03% 27 2685 0.03% 28 3426 0.04% 29 5338 0.07% 30 9526 0.12% 31 2657 0.03% 32 3362 0.04% 33 3729 0.05% 34 5641 0.07% 35 10197 0.13% 36 2619 0.03% 37 3386 0.04% 38 4804 0.06% 39 7892 0.10% 40 15208 0.20% 41 3328 0.04% 42 4393 0.06% 43 6092 0.08% 44 9775 0.13% 45 18566 0.24% 46 4142 0.05% 47 5315 0.07% 48 7561 0.10% 49 12447 0.16% 50 22990 0.29% 51 5435 0.07% 52 6679 0.09% 53 9951 0.13% 54 16744 0.21% 55 31044 0.40% 56 7026 0.09% 57 9306 0.12% 58 13726 0.18% 59 23547 0.30% 60 46638 0.60% 61 9451 0.12% 62 12636 0.16% 63 19546 0.25% 64 33618 0.43% 65 61191 0.79% 66 14682 0.19% 67 42016 0.54% 68 7217346 92.61% 7793290 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=28 prefix-density=0.07 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=15 fanout-score=191.48 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.2 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:01:33 Started mapping on | Feb 10 15:01:33 Finished on | Feb 10 15:01:41 Mapping speed, Million of reads per hour | 3506.98 Number of input reads | 7793290 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6900547 Uniquely mapped reads % | 88.54% Average mapped length | 66.83 Number of splices: Total | 1304937 Number of splices: Annotated (sjdb) | 1282599 Number of splices: GT/AG | 1283521 Number of splices: GC/AG | 17800 Number of splices: AT/AC | 1618 Number of splices: Non-canonical | 1998 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251420 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 593242 % of reads mapped to too many loci | 7.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641323 641323 641323 N_multimapping 251420 251420 251420 N_noFeature 336241 3573886 3623534 N_ambiguous 62755 11729 11734 UnstrandedReadsAssigned:6501551 PositiveStrandReadsAssigned:3314932 NegativeStrandReadsAssigned:3265279 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207701 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207701-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,793,290 reads, 7,153,900 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR3207701.ke.tsv 34699 SRR3207701.se.tsv 87100 total ==> SRR3207701.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 298 31.2781 Potri.005G024800.1.v4.1 1035 936 126 27.114 Potri.004G059700.1.v4.1 961 862 10 2.33664 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 169.411 11.998 Potri.016G087400.1.v4.1 270 171 190 223.798 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 53 6.37705 Potri.012G127500.1.v4.1 977 878 989 226.883 ==> SRR3207701.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 649 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 123 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207701 completed mapping pipeline successfully