Starting /dee2/code/volunteer_pipeline.sh SRR3207702 current disk space = 3059016601600 free memory = 1217192848 SRR3207702 SRAfilesize 913a36c564dd07890758697b68ab232e SRR3207702.sra SRR3207702.sra file validated SRR3207702 is single end SRR3207702 is conventional basespace SRR3207702 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207702_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38425 37.0 30.0 39.0 19.0 40.0 2 33.24825 36.0 30.0 39.0 22.0 40.0 3 33.1305 36.0 30.0 39.0 22.0 40.0 4 33.2895 37.0 31.0 39.0 22.0 40.0 5 33.7405 38.0 31.0 40.0 23.0 40.0 6 34.70525 38.0 32.0 40.0 25.0 40.0 7 34.90225 38.0 33.0 40.0 25.0 40.0 8 34.74125 38.0 33.0 40.0 25.0 40.0 9 34.949 38.0 33.0 40.0 25.0 40.0 10 35.1445 38.0 33.0 40.0 27.0 40.0 11 36.17075 38.0 34.0 40.0 31.0 40.0 12 36.2105 38.0 34.0 40.0 31.0 40.0 13 36.195 38.0 34.0 40.0 31.0 40.0 14 36.281 38.0 35.0 40.0 31.0 40.0 15 36.40525 38.0 35.0 40.0 31.0 40.0 16 36.41575 38.0 35.0 40.0 31.0 40.0 17 36.43375 38.0 35.0 40.0 31.0 40.0 18 36.48225 39.0 35.0 40.0 31.0 40.0 19 36.5505 38.0 35.0 40.0 31.0 40.0 20 36.389 38.0 35.0 40.0 31.0 40.0 21 36.5435 38.0 35.0 40.0 31.0 40.0 22 36.51675 38.0 35.0 40.0 31.0 40.0 23 36.53125 38.0 35.0 40.0 31.0 40.0 24 36.58725 38.0 35.0 40.0 31.0 40.0 25 36.58 38.0 35.0 40.0 31.0 40.0 26 36.60325 39.0 35.0 40.0 31.0 40.0 27 36.87875 39.0 36.0 40.0 31.0 40.0 28 36.829 39.0 36.0 40.0 31.0 40.0 29 36.8075 39.0 36.0 40.0 31.0 40.0 30 36.7765 39.0 36.0 40.0 31.0 40.0 31 36.8245 39.0 36.0 40.0 31.0 40.0 32 36.75375 39.0 36.0 40.0 31.0 40.0 33 36.9415 39.0 36.0 40.0 31.0 40.0 34 36.953 39.0 36.0 40.0 31.0 40.0 35 36.9155 39.0 36.0 40.0 31.0 40.0 36 37.054 39.0 37.0 40.0 31.0 40.0 37 36.98875 39.0 36.0 40.0 31.0 40.0 38 36.8675 39.0 36.0 40.0 31.0 40.0 39 36.8855 39.0 36.0 40.0 31.0 40.0 40 36.8425 39.0 36.0 40.0 31.0 40.0 41 36.721 39.0 36.0 40.0 31.0 40.0 42 36.73375 39.0 36.0 40.0 31.0 40.0 43 36.5915 39.0 36.0 40.0 31.0 40.0 44 36.6195 39.0 36.0 40.0 31.0 40.0 45 36.50375 39.0 36.0 40.0 31.0 40.0 46 36.448 39.0 36.0 40.0 31.0 40.0 47 36.413 39.0 36.0 40.0 31.0 40.0 48 36.35725 39.0 36.0 40.0 31.0 40.0 49 36.1525 39.0 35.0 40.0 30.0 40.0 50 36.1 39.0 35.0 40.0 30.0 40.0 51 36.15525 39.0 35.0 40.0 31.0 40.0 52 35.9585 39.0 35.0 40.0 30.0 40.0 53 35.83175 39.0 35.0 40.0 30.0 40.0 54 35.838 38.0 35.0 40.0 30.0 40.0 55 35.73525 38.0 35.0 40.0 30.0 40.0 56 35.55725 38.0 35.0 40.0 29.0 40.0 57 35.422 38.0 35.0 40.0 29.0 40.0 58 35.4305 38.0 35.0 40.0 29.0 40.0 59 35.17825 38.0 35.0 39.0 29.0 40.0 60 35.11225 38.0 34.0 39.0 29.0 40.0 61 34.9175 38.0 34.0 39.0 29.0 40.0 62 34.64875 38.0 33.0 39.0 28.0 40.0 63 34.605 38.0 34.0 39.0 27.0 40.0 64 34.425 38.0 33.0 39.0 27.0 40.0 65 34.16125 38.0 33.0 39.0 27.0 40.0 66 33.94675 37.0 33.0 39.0 26.0 40.0 67 33.77575 37.0 33.0 39.0 25.0 40.0 68 32.437 35.0 31.0 38.0 23.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 0.0 5 1.0 6 1.0 7 1.0 8 2.0 9 1.0 10 1.0 11 2.0 12 3.0 13 0.0 14 8.0 15 8.0 16 5.0 17 6.0 18 10.0 19 11.0 20 12.0 21 15.0 22 15.0 23 17.0 24 30.0 25 34.0 26 33.0 27 49.0 28 57.0 29 91.0 30 66.0 31 82.0 32 94.0 33 122.0 34 186.0 35 328.0 36 432.0 37 676.0 38 726.0 39 858.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.464589235127479 14.138552665464847 30.92969353592583 42.467164563481845 2 18.525 24.05 38.1 19.325 3 23.13078269567392 27.85696424106027 25.756439109777446 23.25581395348837 4 25.874999999999996 34.55 20.1 19.475 5 25.1 34.050000000000004 23.45 17.4 6 18.525 38.35 25.1 18.025 7 16.75 17.424999999999997 44.6 21.224999999999998 8 18.075 22.625 31.424999999999997 27.875 9 20.200000000000003 23.225 30.599999999999998 25.974999999999998 10 19.675 38.175 24.625 17.525 11 25.525 27.075 20.424999999999997 26.974999999999998 12 22.1 23.625 29.299999999999997 24.975 13 18.525 27.675 31.65 22.15 14 20.575 28.299999999999997 29.025000000000002 22.1 15 21.0 27.025 28.325 23.65 16 21.5 28.299999999999997 27.675 22.525000000000002 17 22.275 28.849999999999998 27.55 21.325 18 23.075000000000003 28.825 26.474999999999998 21.625 19 22.075 28.549999999999997 27.125 22.25 20 22.3 27.950000000000003 27.125 22.625 21 21.4 27.55 28.075 22.975 22 22.400000000000002 28.000000000000004 27.150000000000002 22.45 23 22.775000000000002 28.025 27.175 22.025 24 21.75 28.725 26.3 23.225 25 22.1 28.65 26.400000000000002 22.85 26 21.45 27.950000000000003 28.925 21.675 27 21.825 27.900000000000002 27.150000000000002 23.125 28 21.65 28.499999999999996 28.000000000000004 21.85 29 21.175 28.325 27.875 22.625 30 21.85 27.950000000000003 28.499999999999996 21.7 31 21.7 27.425 27.900000000000002 22.975 32 22.075 27.725 27.125 23.075000000000003 33 20.9 28.95 27.900000000000002 22.25 34 22.0 28.325 27.675 22.0 35 21.0 28.849999999999998 27.825 22.325 36 21.725 27.6 28.199999999999996 22.475 37 21.075 26.85 28.249999999999996 23.825 38 21.5 28.175 28.375 21.95 39 21.175 29.125 27.474999999999998 22.225 40 22.075 28.15 27.575 22.2 41 22.275 28.199999999999996 27.525 22.0 42 20.825 29.049999999999997 27.325 22.8 43 22.15 28.199999999999996 28.325 21.325 44 21.75 27.625 28.175 22.45 45 21.325 29.025000000000002 27.125 22.525000000000002 46 22.3 27.275 28.050000000000004 22.375 47 21.65 27.375 28.025 22.95 48 21.075 29.425 27.474999999999998 22.025 49 21.925 28.000000000000004 27.700000000000003 22.375 50 20.875 28.325 28.225 22.575 51 21.975 28.449999999999996 28.050000000000004 21.525 52 22.775000000000002 28.175 27.224999999999998 21.825 53 21.349999999999998 27.675 28.1 22.875 54 22.125 26.924999999999997 28.925 22.025 55 22.975 27.175 27.775 22.075 56 21.55 28.249999999999996 26.924999999999997 23.275000000000002 57 20.9 27.875 28.275 22.95 58 21.925 26.1 29.125 22.85 59 22.575 27.375 28.549999999999997 21.5 60 20.45 28.675 28.349999999999998 22.525000000000002 61 22.45 27.975 26.650000000000002 22.925 62 22.625 29.349999999999998 26.450000000000003 21.575 63 20.45 27.650000000000002 29.9 22.0 64 22.225 27.750000000000004 27.275 22.75 65 22.075 27.075 27.750000000000004 23.1 66 21.275 29.45 27.800000000000004 21.475 67 21.925 27.675 27.825 22.575 68 22.925 27.825 26.55 22.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.0 20 3.0 21 2.5 22 2.0 23 7.5 24 10.0 25 7.0 26 10.5 27 22.5 28 31.0 29 27.5 30 41.0 31 58.0 32 68.0 33 92.0 34 106.0 35 128.0 36 172.0 37 194.0 38 217.0 39 257.0 40 289.5 41 305.0 42 333.5 43 358.0 44 354.0 45 343.5 46 326.5 47 320.0 48 289.5 49 237.5 50 216.0 51 194.5 52 150.5 53 128.0 54 114.5 55 83.0 56 65.0 57 61.0 58 48.5 59 40.0 60 32.5 61 21.0 62 17.0 63 15.0 64 9.5 65 7.0 66 8.0 67 5.5 68 3.0 69 3.0 70 3.5 71 3.5 72 3.0 73 2.0 74 3.0 75 5.0 76 2.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.40221216691804923 0.8 3 0.0 0.0 4 0.050276520864756154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.15 0.0 0.0 0.0 0.0 16 0.15 0.0 0.0 0.0 0.0 17 0.15 0.0 0.0 0.0 0.0 18 0.15 0.0 0.0 0.0 0.0 19 0.15 0.0 0.0 0.0 0.0 20 0.15 0.0 0.0 0.0 0.0 21 0.15 0.0 0.0 0.0 0.0 22 0.15 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.175 0.0 0.0 0.0 0.0 28 0.175 0.0 0.0 0.0 0.0 29 0.175 0.0 0.0 0.0 0.0 30 0.175 0.0 0.0 0.0 0.0 31 0.175 0.0 0.0 0.0 0.0 32 0.175 0.0 0.0 0.0 0.0 33 0.175 0.0 0.0 0.0 0.0 34 0.175 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 38 0.175 0.0 0.0 0.0 0.0 39 0.175 0.0 0.0 0.0 0.0 40 0.175 0.0 0.0 0.0 0.0 41 0.175 0.0 0.0 0.0 0.0 42 0.2 0.0 0.0 0.0 0.0 43 0.2 0.0 0.0 0.0 0.0 44 0.2 0.0 0.0 0.0 0.0 45 0.2 0.0 0.0 0.0 0.0 46 0.2 0.0 0.0 0.0 0.0 47 0.2 0.0 0.0 0.0 0.0 48 0.2 0.0 0.0 0.0 0.0 49 0.2 0.0 0.0 0.0 0.0 50 0.2 0.0 0.0 0.0 0.0 51 0.2 0.0 0.0 0.0 0.0 52 0.2 0.0 0.0 0.0 0.0 53 0.225 0.0 0.0 0.0 0.0 54 0.225 0.0 0.0 0.0 0.0 55 0.225 0.0 0.0 0.0 0.0 56 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459307 spots for SRR3207702.sra Written 459307 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra Read 459298 spots for SRR3207702.sra Written 459298 spots for SRR3207702.sra SRR ids: ['SRR3207702.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s3n0zlaj SRR3207702.sra spots: 9185969 blocks: [[1, 459298], [459299, 918596], [918597, 1377894], [1377895, 1837192], [1837193, 2296490], [2296491, 2755788], [2755789, 3215086], [3215087, 3674384], [3674385, 4133682], [4133683, 4592980], [4592981, 5052278], [5052279, 5511576], [5511577, 5970874], [5970875, 6430172], [6430173, 6889470], [6889471, 7348768], [7348769, 7808066], [7808067, 8267364], [8267365, 8726662], [8726663, 9185969]] SRR3207702 file size 1920301 SRR3207702 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207702 SRR3207702_1.fastq Input file: SRR3207702_1.fastq trimmed: SRR3207702-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:31:02 2025 >> started Mon Feb 10 14:31:07 2025 >> done (4.544s) 9185969 reads processed; of these: 50091 ( 0.55%) short reads filtered out after trimming by size control 71658 ( 0.78%) empty reads filtered out after trimming by size control 9064220 (98.67%) reads available; of these: 654095 ( 7.22%) trimmed reads available after processing 8410125 (92.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2122 0.02% 19 3765 0.04% 20 7411 0.08% 21 1849 0.02% 22 2375 0.03% 23 3526 0.04% 24 5610 0.06% 25 11061 0.12% 26 3021 0.03% 27 2913 0.03% 28 3907 0.04% 29 6149 0.07% 30 10722 0.12% 31 3023 0.03% 32 3762 0.04% 33 4149 0.05% 34 6591 0.07% 35 11459 0.13% 36 3044 0.03% 37 3759 0.04% 38 5506 0.06% 39 8825 0.10% 40 17156 0.19% 41 3746 0.04% 42 4913 0.05% 43 6855 0.08% 44 11195 0.12% 45 20964 0.23% 46 4732 0.05% 47 6037 0.07% 48 8731 0.10% 49 14085 0.16% 50 26451 0.29% 51 6042 0.07% 52 7797 0.09% 53 11051 0.12% 54 18880 0.21% 55 35854 0.40% 56 8025 0.09% 57 10277 0.11% 58 15557 0.17% 59 26505 0.29% 60 53217 0.59% 61 10613 0.12% 62 14474 0.16% 63 22141 0.24% 64 38877 0.43% 65 70352 0.78% 66 16800 0.19% 67 48219 0.53% 68 8410125 92.78% 9064220 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.07 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=128.43 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=18.6 sequence=AAGAAGAAGAAA Started job on | Feb 10 14:31:20 Started mapping on | Feb 10 14:31:20 Finished on | Feb 10 14:31:30 Mapping speed, Million of reads per hour | 3263.12 Number of input reads | 9064220 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8004065 Uniquely mapped reads % | 88.30% Average mapped length | 66.85 Number of splices: Total | 1500733 Number of splices: Annotated (sjdb) | 1475925 Number of splices: GT/AG | 1477064 Number of splices: GC/AG | 19324 Number of splices: AT/AC | 1920 Number of splices: Non-canonical | 2425 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284574 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 721565 % of reads mapped to too many loci | 7.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 775581 775581 775581 N_multimapping 284574 284574 284574 N_noFeature 373824 4143667 4185557 N_ambiguous 74960 13020 13348 UnstrandedReadsAssigned:7555281 PositiveStrandReadsAssigned:3847378 NegativeStrandReadsAssigned:3805160 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207702 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207702-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,064,220 reads, 8,331,909 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR3207702.ke.tsv 34699 SRR3207702.se.tsv 87100 total ==> SRR3207702.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 277 25.6797 Potri.005G024800.1.v4.1 1035 936 81 15.3955 Potri.004G059700.1.v4.1 961 862 15 3.09577 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 202.426 12.6626 Potri.016G087400.1.v4.1 270 171 269 279.86 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 39 4.14471 Potri.012G127500.1.v4.1 977 878 1053 213.363 ==> SRR3207702.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 857 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 136 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207702 completed mapping pipeline successfully