Starting /dee2/code/volunteer_pipeline.sh SRR3207703 current disk space = 3059075805184 free memory = 1149478076 SRR3207703 SRAfilesize 213757e5c89eabd3298c580fefd4dd2d SRR3207703.sra SRR3207703.sra file validated SRR3207703 is single end SRR3207703 is conventional basespace SRR3207703 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207703_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82025 37.0 30.0 39.0 19.0 40.0 2 33.418 36.0 31.0 40.0 22.0 40.0 3 33.35025 37.0 31.0 40.0 22.0 40.0 4 33.48725 38.0 31.0 40.0 22.0 40.0 5 33.8415 38.0 31.0 40.0 23.0 40.0 6 34.77975 38.0 33.0 40.0 25.0 40.0 7 34.96125 38.0 33.0 40.0 25.0 40.0 8 34.785 38.0 33.0 40.0 25.0 40.0 9 35.08575 38.0 33.0 40.0 25.0 40.0 10 35.091 38.0 33.0 40.0 25.0 40.0 11 36.281 38.0 34.0 40.0 31.0 40.0 12 36.29025 38.0 35.0 40.0 31.0 40.0 13 36.3125 38.0 35.0 40.0 31.0 40.0 14 36.336 38.0 35.0 40.0 31.0 40.0 15 36.41525 38.0 35.0 40.0 31.0 40.0 16 36.62575 39.0 35.0 40.0 31.0 40.0 17 36.53925 39.0 35.0 40.0 31.0 40.0 18 36.61925 39.0 35.0 40.0 31.0 40.0 19 36.51875 39.0 35.0 40.0 31.0 40.0 20 36.48925 39.0 35.0 40.0 31.0 40.0 21 36.552 39.0 35.0 40.0 31.0 40.0 22 36.52375 39.0 35.0 40.0 31.0 40.0 23 36.52875 38.0 35.0 40.0 31.0 40.0 24 36.63925 39.0 35.0 40.0 31.0 40.0 25 36.56125 38.0 35.0 40.0 31.0 40.0 26 36.52225 39.0 35.0 40.0 31.0 40.0 27 36.78725 39.0 36.0 40.0 31.0 40.0 28 36.73925 39.0 36.0 40.0 31.0 40.0 29 36.78625 39.0 36.0 40.0 31.0 40.0 30 36.7245 39.0 36.0 40.0 31.0 40.0 31 36.669 39.0 36.0 40.0 31.0 40.0 32 36.6445 39.0 36.0 40.0 31.0 40.0 33 36.852 39.0 36.0 40.0 31.0 40.0 34 36.801 39.0 36.0 40.0 31.0 40.0 35 36.83675 39.0 36.0 40.0 31.0 40.0 36 37.0 39.0 37.0 40.0 32.0 40.0 37 36.8165 39.0 36.0 40.0 31.0 40.0 38 36.84275 39.0 36.0 40.0 31.0 40.0 39 36.7755 39.0 36.0 40.0 31.0 40.0 40 36.68075 39.0 36.0 40.0 31.0 40.0 41 36.47825 39.0 36.0 40.0 31.0 40.0 42 36.4975 39.0 36.0 40.0 31.0 40.0 43 36.4765 39.0 36.0 40.0 31.0 40.0 44 36.353 39.0 36.0 40.0 31.0 40.0 45 36.32225 39.0 35.0 40.0 31.0 40.0 46 36.29625 39.0 36.0 40.0 31.0 40.0 47 36.28975 39.0 36.0 40.0 31.0 40.0 48 36.227 39.0 36.0 40.0 31.0 40.0 49 36.14325 39.0 35.0 40.0 31.0 40.0 50 36.166 39.0 35.0 40.0 31.0 40.0 51 35.90425 39.0 35.0 40.0 30.0 40.0 52 35.80025 39.0 35.0 40.0 30.0 40.0 53 35.7615 39.0 35.0 40.0 30.0 40.0 54 35.6295 39.0 35.0 40.0 30.0 40.0 55 35.4805 38.0 35.0 40.0 29.0 40.0 56 35.4735 38.0 35.0 40.0 29.0 40.0 57 35.3225 38.0 35.0 40.0 29.0 40.0 58 35.25775 38.0 35.0 40.0 29.0 40.0 59 35.121 38.0 35.0 40.0 29.0 40.0 60 34.964 38.0 35.0 40.0 28.0 40.0 61 34.86275 38.0 35.0 39.0 28.0 40.0 62 34.42575 38.0 33.0 39.0 27.0 40.0 63 34.55975 38.0 34.0 39.0 27.0 40.0 64 34.308 38.0 33.0 39.0 27.0 40.0 65 33.9985 38.0 33.0 39.0 25.0 40.0 66 33.766 38.0 33.0 39.0 25.0 40.0 67 33.5365 37.0 33.0 39.0 23.0 40.0 68 32.24725 35.0 31.0 38.0 20.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 3.0 10 5.0 11 3.0 12 5.0 13 3.0 14 9.0 15 9.0 16 10.0 17 5.0 18 16.0 19 3.0 20 20.0 21 10.0 22 16.0 23 26.0 24 13.0 25 28.0 26 39.0 27 57.0 28 61.0 29 80.0 30 61.0 31 82.0 32 102.0 33 137.0 34 171.0 35 243.0 36 409.0 37 651.0 38 782.0 39 916.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.437403400309119 14.45131375579598 30.886141164348274 43.225141679546624 2 19.075 25.8 36.55 18.575 3 21.25 29.375 26.825 22.55 4 24.7 32.975 20.674999999999997 21.65 5 24.825 35.575 23.3 16.3 6 18.55 37.625 24.825 19.0 7 16.950000000000003 17.65 44.85 20.549999999999997 8 18.9 23.674999999999997 30.25 27.175 9 20.625 23.625 32.074999999999996 23.674999999999997 10 19.725 39.875 22.85 17.549999999999997 11 25.75 28.225 20.875 25.15 12 20.8 23.825 29.099999999999998 26.275 13 19.075 28.549999999999997 30.775000000000002 21.6 14 19.650000000000002 28.625 28.625 23.1 15 19.75 27.200000000000003 30.099999999999998 22.95 16 22.875 27.224999999999998 27.450000000000003 22.45 17 22.25 28.299999999999997 27.275 22.175 18 21.275 28.199999999999996 28.849999999999998 21.675 19 22.175 27.950000000000003 27.675 22.2 20 22.6 28.125 27.725 21.55 21 21.875 27.85 28.249999999999996 22.025 22 20.974999999999998 29.25 27.474999999999998 22.3 23 20.974999999999998 30.15 27.525 21.349999999999998 24 21.925 29.075 26.450000000000003 22.55 25 22.525000000000002 29.025000000000002 25.874999999999996 22.575 26 21.85 29.375 25.900000000000002 22.875 27 22.55 28.95 26.5 22.0 28 21.75 28.325 27.500000000000004 22.425 29 22.025 28.475 27.900000000000002 21.6 30 22.45 27.400000000000002 28.9 21.25 31 21.875 28.849999999999998 26.200000000000003 23.075000000000003 32 22.1 28.95 27.750000000000004 21.2 33 21.725 27.85 28.4 22.025 34 21.8 28.075 27.474999999999998 22.650000000000002 35 21.3 28.749999999999996 28.125 21.825 36 20.674999999999997 27.800000000000004 29.299999999999997 22.225 37 22.8 27.675 26.375 23.150000000000002 38 20.925 28.525 28.625 21.925 39 22.725 29.45 27.175 20.65 40 21.95 28.599999999999998 26.724999999999998 22.725 41 22.725 26.825 28.125 22.325 42 21.05 29.15 28.050000000000004 21.75 43 22.05 28.4 26.900000000000002 22.650000000000002 44 21.475 28.175 27.425 22.925 45 21.875 28.4 28.199999999999996 21.525 46 20.95 28.225 28.175 22.650000000000002 47 22.8 29.375 25.85 21.975 48 21.15 30.275000000000002 27.224999999999998 21.349999999999998 49 21.625 27.900000000000002 28.125 22.35 50 21.875 27.675 27.750000000000004 22.7 51 20.674999999999997 28.825 28.349999999999998 22.15 52 21.15 27.175 28.199999999999996 23.474999999999998 53 21.525 28.175 27.725 22.575 54 22.35 27.525 26.950000000000003 23.175 55 20.674999999999997 28.475 27.400000000000002 23.45 56 20.7 27.575 28.349999999999998 23.375 57 21.275 27.875 28.025 22.825 58 20.825 28.349999999999998 28.625 22.2 59 22.225 27.500000000000004 28.575 21.7 60 21.55 26.700000000000003 29.25 22.5 61 21.8 27.375 28.025 22.8 62 21.775 28.7 26.825 22.7 63 21.85 28.249999999999996 28.175 21.725 64 21.075 28.675 28.075 22.175 65 21.224999999999998 29.475 28.849999999999998 20.45 66 22.225 28.575 27.625 21.575 67 20.925 28.775000000000002 27.800000000000004 22.5 68 20.974999999999998 29.375 28.050000000000004 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 3.5 21 9.5 22 12.0 23 10.0 24 10.0 25 12.0 26 19.0 27 30.0 28 34.0 29 40.5 30 48.5 31 50.0 32 71.5 33 106.5 34 120.0 35 134.5 36 172.0 37 195.0 38 207.5 39 242.5 40 290.5 41 316.0 42 333.5 43 338.5 44 326.0 45 323.0 46 323.0 47 326.0 48 307.5 49 262.0 50 235.0 51 190.5 52 140.0 53 134.0 54 115.5 55 78.5 56 60.0 57 51.0 58 38.0 59 34.0 60 24.0 61 14.0 62 14.0 63 12.5 64 11.5 65 9.5 66 7.0 67 6.0 68 6.0 69 7.0 70 4.5 71 1.5 72 1.0 73 2.0 74 2.5 75 2.0 76 2.0 77 2.0 78 2.0 79 1.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44444444444444 98.45 2 0.4797979797979798 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025252525252525252 0.17500000000000002 8 0.025252525252525252 0.2 9 0.025252525252525252 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAA 9 0.22499999999999998 TruSeq Adapter, Index 19 (97% over 40bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAA 8 0.2 TruSeq Adapter, Index 19 (97% over 40bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTGAAA 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10 0.275 0.0 0.0 0.0 0.0 11 0.275 0.0 0.0 0.0 0.0 12 0.275 0.0 0.0 0.0 0.0 13 0.275 0.0 0.0 0.0 0.0 14 0.275 0.0 0.0 0.0 0.0 15 0.275 0.0 0.0 0.0 0.0 16 0.275 0.0 0.0 0.0 0.0 17 0.3 0.0 0.0 0.0 0.0 18 0.3 0.0 0.0 0.0 0.0 19 0.3 0.0 0.0 0.0 0.0 20 0.3 0.0 0.0 0.0 0.0 21 0.3 0.0 0.0 0.0 0.0 22 0.3 0.0 0.0 0.0 0.0 23 0.3 0.0 0.0 0.0 0.0 24 0.3 0.0 0.0 0.0 0.0 25 0.3 0.0 0.0 0.0 0.0 26 0.3 0.0 0.0 0.0 0.0 27 0.3 0.0 0.0 0.0 0.0 28 0.3 0.0 0.0 0.0 0.0 29 0.3 0.0 0.0 0.0 0.0 30 0.3 0.0 0.0 0.0 0.0 31 0.3 0.0 0.0 0.0 0.0 32 0.3 0.0 0.0 0.0 0.0 33 0.3 0.0 0.0 0.0 0.0 34 0.3 0.0 0.0 0.0 0.0 35 0.3 0.0 0.0 0.0 0.0 36 0.3 0.0 0.0 0.0 0.0 37 0.3 0.0 0.0 0.0 0.0 38 0.3 0.0 0.0 0.0 0.0 39 0.3 0.0 0.0 0.0 0.0 40 0.3 0.0 0.0 0.0 0.0 41 0.3 0.0 0.0 0.0 0.0 42 0.3 0.0 0.0 0.0 0.0 43 0.3 0.0 0.0 0.0 0.0 44 0.3 0.0 0.0 0.0 0.0 45 0.3 0.0 0.0 0.0 0.0 46 0.3 0.0 0.0 0.0 0.0 47 0.3 0.0 0.0 0.0 0.0 48 0.3 0.0 0.0 0.0 0.0 49 0.3 0.0 0.0 0.0 0.0 50 0.3 0.0 0.0 0.0 0.0 51 0.3 0.0 0.0 0.0 0.0 52 0.3 0.0 0.0 0.0 0.0 53 0.3 0.0 0.0 0.0 0.0 54 0.3 0.0 0.0 0.0 0.0 55 0.3 0.0 0.0 0.0 0.0 56 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457380 spots for SRR3207703.sra Written 457380 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra Read 457378 spots for SRR3207703.sra Written 457378 spots for SRR3207703.sra SRR ids: ['SRR3207703.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hkqx8f9e SRR3207703.sra spots: 9147562 blocks: [[1, 457378], [457379, 914756], [914757, 1372134], [1372135, 1829512], [1829513, 2286890], [2286891, 2744268], [2744269, 3201646], [3201647, 3659024], [3659025, 4116402], [4116403, 4573780], [4573781, 5031158], [5031159, 5488536], [5488537, 5945914], [5945915, 6403292], [6403293, 6860670], [6860671, 7318048], [7318049, 7775426], [7775427, 8232804], [8232805, 8690182], [8690183, 9147562]] SRR3207703 file size 1912266 SRR3207703 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207703 SRR3207703_1.fastq Input file: SRR3207703_1.fastq trimmed: SRR3207703-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:38:29 2025 >> started Mon Feb 10 14:38:33 2025 >> done (4.240s) 9147562 reads processed; of these: 50082 ( 0.55%) short reads filtered out after trimming by size control 105492 ( 1.15%) empty reads filtered out after trimming by size control 8991988 (98.30%) reads available; of these: 619336 ( 6.89%) trimmed reads available after processing 8372652 (93.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2172 0.02% 19 3923 0.04% 20 9083 0.10% 21 1753 0.02% 22 2306 0.03% 23 3308 0.04% 24 5610 0.06% 25 11017 0.12% 26 2724 0.03% 27 2856 0.03% 28 3813 0.04% 29 5796 0.06% 30 10485 0.12% 31 2761 0.03% 32 3452 0.04% 33 3919 0.04% 34 6151 0.07% 35 11138 0.12% 36 2867 0.03% 37 3803 0.04% 38 5164 0.06% 39 8459 0.09% 40 16422 0.18% 41 3624 0.04% 42 4552 0.05% 43 6506 0.07% 44 10711 0.12% 45 20057 0.22% 46 4382 0.05% 47 5675 0.06% 48 8084 0.09% 49 13403 0.15% 50 25176 0.28% 51 5668 0.06% 52 7336 0.08% 53 10414 0.12% 54 17874 0.20% 55 33905 0.38% 56 7453 0.08% 57 9726 0.11% 58 14416 0.16% 59 25141 0.28% 60 50227 0.56% 61 9899 0.11% 62 13422 0.15% 63 20377 0.23% 64 35692 0.40% 65 66021 0.73% 66 15410 0.17% 67 45203 0.50% 68 8372652 93.11% 8991988 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=26 prefix-density=0.06 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=7 fanout-score=124.95 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=18.2 sequence=AAGAAGAAGAAA Started job on | Feb 10 14:38:48 Started mapping on | Feb 10 14:38:48 Finished on | Feb 10 14:38:57 Mapping speed, Million of reads per hour | 3596.80 Number of input reads | 8991988 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8043271 Uniquely mapped reads % | 89.45% Average mapped length | 66.89 Number of splices: Total | 1464328 Number of splices: Annotated (sjdb) | 1436568 Number of splices: GT/AG | 1438342 Number of splices: GC/AG | 21412 Number of splices: AT/AC | 1952 Number of splices: Non-canonical | 2622 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297203 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 588456 % of reads mapped to too many loci | 6.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651514 651514 651514 N_multimapping 297203 297203 297203 N_noFeature 421245 4169180 4245713 N_ambiguous 77904 14257 14135 UnstrandedReadsAssigned:7544122 PositiveStrandReadsAssigned:3859834 NegativeStrandReadsAssigned:3783423 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207703 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207703-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,991,988 reads, 8,209,467 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR3207703.ke.tsv 34699 SRR3207703.se.tsv 87100 total ==> SRR3207703.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 473 40.5034 Potri.005G024800.1.v4.1 1035 936 353 61.9732 Potri.004G059700.1.v4.1 961 862 11 2.09696 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 208.441 12.0437 Potri.016G087400.1.v4.1 270 171 248 238.32 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 71 6.9696 Potri.012G127500.1.v4.1 977 878 1056 197.64 ==> SRR3207703.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 585 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR3207703 completed mapping pipeline successfully