Starting /dee2/code/volunteer_pipeline.sh SRR3207704 current disk space = 3059032915968 free memory = 1251262484 SRR3207704 SRAfilesize 5dd437cacf0d3f975af35e7664a89d70 SRR3207704.sra SRR3207704.sra file validated SRR3207704 is single end SRR3207704 is conventional basespace SRR3207704 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207704_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.34525 39.0 37.0 40.0 33.0 40.0 2 37.06025 39.0 36.0 40.0 33.0 40.0 3 36.911 39.0 36.0 40.0 32.0 40.0 4 36.75625 39.0 36.0 40.0 31.0 40.0 5 36.86975 39.0 36.0 40.0 31.0 40.0 6 36.99075 39.0 36.0 40.0 33.0 40.0 7 37.073 39.0 36.0 40.0 33.0 40.0 8 36.7775 39.0 36.0 40.0 31.0 40.0 9 36.873 39.0 36.0 40.0 31.0 40.0 10 36.73275 38.0 36.0 40.0 31.0 40.0 11 36.636 38.0 35.0 40.0 31.0 40.0 12 36.62475 38.0 35.0 40.0 31.0 40.0 13 36.72075 38.0 36.0 40.0 31.0 40.0 14 36.69075 38.0 35.0 40.0 31.0 40.0 15 36.6265 38.0 35.0 40.0 31.0 40.0 16 36.58175 38.0 35.0 39.0 31.0 40.0 17 36.4875 38.0 35.0 40.0 31.0 40.0 18 36.5415 38.0 35.0 40.0 31.0 40.0 19 36.4605 38.0 35.0 40.0 31.0 40.0 20 36.3415 38.0 35.0 40.0 30.0 40.0 21 36.462 38.0 35.0 40.0 31.0 40.0 22 36.1495 38.0 35.0 39.0 30.0 40.0 23 36.1555 38.0 35.0 39.0 30.0 40.0 24 36.328 38.0 35.0 39.0 31.0 40.0 25 36.21925 38.0 35.0 39.0 30.0 40.0 26 36.1285 38.0 35.0 39.0 30.0 40.0 27 35.7285 38.0 35.0 39.0 29.0 40.0 28 35.5025 38.0 35.0 39.0 29.0 40.0 29 35.612 38.0 35.0 39.0 29.0 40.0 30 35.65825 38.0 35.0 39.0 29.0 40.0 31 35.3315 38.0 35.0 39.0 29.0 40.0 32 35.0415 38.0 34.0 39.0 27.0 40.0 33 34.839 38.0 33.0 39.0 27.0 40.0 34 34.69625 38.0 33.0 39.0 27.0 40.0 35 34.86625 38.0 33.0 39.0 27.0 40.0 36 34.5685 38.0 33.0 39.0 27.0 40.0 37 33.832 37.0 33.0 39.0 25.0 40.0 38 34.15275 37.0 33.0 39.0 26.0 40.0 39 34.175 37.0 33.0 39.0 26.0 40.0 40 33.72875 37.0 33.0 39.0 25.0 40.0 41 33.716 37.0 33.0 39.0 23.0 40.0 42 33.5785 37.0 33.0 39.0 23.0 40.0 43 33.41675 36.0 32.0 39.0 23.0 40.0 44 33.19925 36.0 32.0 39.0 23.0 40.0 45 33.19425 36.0 32.0 39.0 23.0 40.0 46 33.38575 36.0 32.0 39.0 23.0 40.0 47 33.09675 36.0 32.0 39.0 23.0 40.0 48 33.161 36.0 32.0 39.0 23.0 40.0 49 32.875 36.0 31.0 39.0 23.0 40.0 50 32.679 36.0 31.0 39.0 23.0 40.0 51 32.514 36.0 32.0 39.0 21.0 40.0 52 32.38125 36.0 31.0 38.0 22.0 40.0 53 32.2025 36.0 31.0 38.0 21.0 39.0 54 31.64725 35.0 30.0 38.0 18.0 39.0 55 31.69425 35.0 30.0 38.0 18.0 39.0 56 31.336 35.0 30.0 38.0 15.0 39.0 57 30.5955 35.0 29.0 38.0 10.0 39.0 58 30.482 34.0 29.0 38.0 10.0 39.0 59 30.458 35.0 29.0 38.0 8.0 39.0 60 30.053 34.0 29.0 37.0 2.0 39.0 61 29.814 34.0 29.0 37.0 2.0 39.0 62 29.6245 34.0 28.0 37.0 2.0 39.0 63 29.339 33.0 28.0 37.0 2.0 39.0 64 29.23425 33.0 28.0 37.0 2.0 39.0 65 28.98025 33.0 27.0 37.0 2.0 39.0 66 28.65425 34.0 27.0 37.0 2.0 39.0 67 28.19 33.0 27.0 36.0 2.0 39.0 68 28.18475 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 1.0 6 1.0 7 3.0 8 7.0 9 5.0 10 8.0 11 11.0 12 18.0 13 9.0 14 14.0 15 22.0 16 17.0 17 14.0 18 14.0 19 23.0 20 23.0 21 26.0 22 33.0 23 44.0 24 37.0 25 44.0 26 59.0 27 48.0 28 75.0 29 106.0 30 97.0 31 125.0 32 167.0 33 229.0 34 251.0 35 367.0 36 515.0 37 594.0 38 667.0 39 316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.88922457200403 15.735146022155085 18.10171198388721 46.273917421953676 2 18.35 26.150000000000002 36.25 19.25 3 22.2 28.675 26.525 22.6 4 23.974999999999998 33.025 21.224999999999998 21.775 5 24.224999999999998 35.4 23.45 16.925 6 17.375 38.25 25.374999999999996 19.0 7 15.5 17.45 46.525 20.525 8 19.35 23.849999999999998 29.599999999999998 27.200000000000003 9 19.650000000000002 23.125 31.825 25.4 10 19.175 40.225 23.549999999999997 17.05 11 24.95 29.549999999999997 20.9 24.6 12 20.65 24.15 29.625 25.575 13 18.85 28.000000000000004 31.874999999999996 21.275 14 19.675 29.025000000000002 29.15 22.15 15 21.475 27.525 29.049999999999997 21.95 16 20.825 27.85 28.625 22.7 17 22.15 28.299999999999997 27.525 22.025 18 21.175 27.725 28.549999999999997 22.55 19 21.55 28.175 28.549999999999997 21.725 20 22.175 28.325 27.450000000000003 22.05 21 20.8 29.075 28.725 21.4 22 21.475 26.5 29.2 22.825 23 22.05 29.299999999999997 27.825 20.825 24 21.625 29.625 27.325 21.425 25 21.575 29.475 26.5 22.45 26 21.15 29.025000000000002 27.675 22.15 27 20.730182545636406 29.132283070767688 29.057264316079017 21.080270067516878 28 22.255563890972745 27.7569392348087 27.93198299574894 22.05551387846962 29 21.55 28.675 27.800000000000004 21.975 30 21.10527631907977 27.881970492623154 29.632408102025504 21.380345086271568 31 21.405351337834457 29.132283070767688 27.831957989497376 21.630407601900476 32 21.0 28.4 28.299999999999997 22.3 33 20.980245061265315 28.432108027006752 28.782195548887223 21.80545136284071 34 21.4 28.499999999999996 28.525 21.575 35 21.825 27.650000000000002 29.299999999999997 21.224999999999998 36 21.475 28.775000000000002 28.449999999999996 21.3 37 21.725 29.925 27.1 21.25 38 22.375 29.9 25.7 22.025 39 21.330332583145786 29.532383095773945 26.906726681670417 22.230557639409852 40 20.9 29.725 27.875 21.5 41 22.625 28.15 27.675 21.55 42 20.830207551887973 29.532383095773945 28.257064266066518 21.380345086271568 43 20.930232558139537 28.982245561390346 28.707176794198553 21.380345086271568 44 20.375 28.275 29.275000000000002 22.075 45 22.280570142535634 29.382345586396596 26.9567391847962 21.380345086271568 46 22.2 27.05 29.7 21.05 47 20.925 28.775000000000002 28.799999999999997 21.5 48 21.955488872218055 28.907226806701676 28.307076769192296 20.830207551887973 49 23.325000000000003 26.700000000000003 28.499999999999996 21.475 50 22.650000000000002 27.650000000000002 28.449999999999996 21.25 51 21.3 28.000000000000004 27.925 22.775000000000002 52 22.355588897224308 27.106776694173547 27.656914228557138 22.88072018004501 53 21.630407601900476 29.08227056764191 28.40710177544386 20.880220055013755 54 21.425 27.825 29.099999999999998 21.65 55 22.5 28.449999999999996 27.325 21.725 56 21.0 28.975 28.95 21.075 57 21.6 28.425 28.325 21.65 58 22.35 27.175 28.999999999999996 21.475 59 20.974999999999998 28.65 29.2 21.175 60 22.075 28.249999999999996 27.6 22.075 61 20.7 28.975 28.15 22.175 62 21.75 28.075 27.575 22.6 63 22.225 28.025 28.7 21.05 64 22.275 28.4 28.1 21.224999999999998 65 21.575 28.249999999999996 29.15 21.025 66 21.8 28.475 28.249999999999996 21.475 67 21.85 27.725 29.25 21.175 68 21.9 30.075000000000003 27.1 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 3.5 21 7.5 22 9.0 23 9.5 24 12.0 25 14.0 26 17.0 27 27.5 28 35.0 29 46.0 30 61.5 31 66.0 32 70.5 33 100.0 34 125.0 35 140.0 36 177.5 37 200.0 38 239.5 39 280.5 40 309.5 41 337.0 42 348.0 43 356.0 44 353.0 45 334.5 46 307.0 47 298.0 48 268.0 49 216.5 50 195.0 51 179.5 52 144.0 53 124.0 54 100.5 55 62.0 56 47.0 57 43.0 58 36.5 59 34.0 60 28.0 61 17.5 62 13.0 63 10.0 64 8.0 65 8.0 66 7.0 67 5.5 68 3.0 69 2.0 70 2.0 71 3.5 72 5.0 73 5.0 74 3.5 75 2.0 76 3.0 77 3.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.0 30 0.025 31 0.025 32 0.0 33 0.025 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.0 41 0.0 42 0.025 43 0.025 44 0.0 45 0.025 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248339 spots for SRR3207704.sra Written 248339 spots for SRR3207704.sra Read 248355 spots for SRR3207704.sra Written 248355 spots for SRR3207704.sra SRR ids: ['SRR3207704.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pgouqhoh SRR3207704.sra spots: 4966796 blocks: [[1, 248339], [248340, 496678], [496679, 745017], [745018, 993356], [993357, 1241695], [1241696, 1490034], [1490035, 1738373], [1738374, 1986712], [1986713, 2235051], [2235052, 2483390], [2483391, 2731729], [2731730, 2980068], [2980069, 3228407], [3228408, 3476746], [3476747, 3725085], [3725086, 3973424], [3973425, 4221763], [4221764, 4470102], [4470103, 4718441], [4718442, 4966796]] SRR3207704 file size 1042603 SRR3207704 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207704 SRR3207704_1.fastq Input file: SRR3207704_1.fastq trimmed: SRR3207704-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:43:19 2025 >> started Mon Feb 10 14:43:21 2025 >> done (2.304s) 4966796 reads processed; of these: 10576 ( 0.21%) short reads filtered out after trimming by size control 6460 ( 0.13%) empty reads filtered out after trimming by size control 4949760 (99.66%) reads available; of these: 401677 ( 8.12%) trimmed reads available after processing 4548083 (91.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1201 0.02% 19 2050 0.04% 20 3174 0.06% 21 964 0.02% 22 1415 0.03% 23 2182 0.04% 24 3930 0.08% 25 6259 0.13% 26 1730 0.03% 27 2203 0.04% 28 3049 0.06% 29 4646 0.09% 30 7584 0.15% 31 1849 0.04% 32 2275 0.05% 33 3195 0.06% 34 4770 0.10% 35 7237 0.15% 36 1845 0.04% 37 2376 0.05% 38 3209 0.06% 39 5060 0.10% 40 7878 0.16% 41 1873 0.04% 42 2759 0.06% 43 4283 0.09% 44 6780 0.14% 45 10201 0.21% 46 2365 0.05% 47 3346 0.07% 48 5276 0.11% 49 9066 0.18% 50 14949 0.30% 51 3659 0.07% 52 5244 0.11% 53 8364 0.17% 54 13731 0.28% 55 24433 0.49% 56 5186 0.10% 57 7499 0.15% 58 11072 0.22% 59 18819 0.38% 60 34096 0.69% 61 6868 0.14% 62 9641 0.19% 63 15580 0.31% 64 26251 0.53% 65 44897 0.91% 66 9434 0.19% 67 15924 0.32% 68 4548083 91.88% 4949760 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=0.07 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=153.65 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=18.3 sequence=TTCTTCTTCTTC Started job on | Feb 10 14:43:50 Started mapping on | Feb 10 14:43:50 Finished on | Feb 10 14:43:56 Mapping speed, Million of reads per hour | 2969.86 Number of input reads | 4949760 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4465011 Uniquely mapped reads % | 90.21% Average mapped length | 66.78 Number of splices: Total | 822042 Number of splices: Annotated (sjdb) | 807775 Number of splices: GT/AG | 808936 Number of splices: GC/AG | 10854 Number of splices: AT/AC | 1078 Number of splices: Non-canonical | 1174 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162416 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 300626 % of reads mapped to too many loci | 6.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322333 322333 322333 N_multimapping 162416 162416 162416 N_noFeature 247535 2318210 2365058 N_ambiguous 43916 7414 7284 UnstrandedReadsAssigned:4173560 PositiveStrandReadsAssigned:2139387 NegativeStrandReadsAssigned:2092669 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207704 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207704-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,949,760 reads, 4,511,865 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR3207704.ke.tsv 34699 SRR3207704.se.tsv 87100 total ==> SRR3207704.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 153 25.5495 Potri.005G024800.1.v4.1 1035 936 55 18.8301 Potri.004G059700.1.v4.1 961 862 14 5.20459 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 102.294 11.5262 Potri.016G087400.1.v4.1 270 171 137 256.738 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16 3.06288 Potri.012G127500.1.v4.1 977 878 685 250.013 ==> SRR3207704.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 552 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 81 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207704 completed mapping pipeline successfully