Starting /dee2/code/volunteer_pipeline.sh SRR3207705 current disk space = 3059037954048 free memory = 1155141880 SRR3207705 SRAfilesize 31d3bc368fb38c20a946faef609d0e94 SRR3207705.sra SRR3207705.sra file validated SRR3207705 is single end SRR3207705 is conventional basespace SRR3207705 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207705_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.536 39.0 38.0 40.0 33.0 40.0 2 37.166 39.0 37.0 40.0 33.0 40.0 3 37.0285 39.0 36.0 40.0 33.0 40.0 4 37.013 39.0 36.0 40.0 32.0 40.0 5 37.047 39.0 36.0 40.0 33.0 40.0 6 37.24575 39.0 36.0 40.0 33.0 40.0 7 37.229 39.0 37.0 40.0 33.0 40.0 8 36.96775 39.0 36.0 40.0 32.0 40.0 9 36.999 39.0 36.0 40.0 33.0 40.0 10 36.922 39.0 36.0 40.0 32.0 40.0 11 36.86575 39.0 36.0 40.0 32.0 40.0 12 36.88575 39.0 36.0 40.0 31.0 40.0 13 36.8275 39.0 36.0 40.0 31.0 40.0 14 36.82375 39.0 36.0 40.0 31.0 40.0 15 36.75175 38.0 36.0 40.0 31.0 40.0 16 36.639 38.0 36.0 40.0 31.0 40.0 17 36.605 38.0 36.0 40.0 31.0 40.0 18 36.62375 38.0 36.0 40.0 31.0 40.0 19 36.5425 38.0 35.0 40.0 31.0 40.0 20 36.4495 38.0 35.0 40.0 31.0 40.0 21 36.50825 38.0 35.0 40.0 31.0 40.0 22 36.3255 38.0 35.0 39.0 30.0 40.0 23 36.203 38.0 35.0 40.0 30.0 40.0 24 36.34225 38.0 35.0 40.0 30.0 40.0 25 36.2245 38.0 35.0 39.0 30.0 40.0 26 36.059 38.0 35.0 39.0 30.0 40.0 27 35.80875 38.0 35.0 39.0 29.0 40.0 28 35.4895 38.0 35.0 39.0 29.0 40.0 29 35.60125 38.0 35.0 39.0 29.0 40.0 30 35.64875 38.0 35.0 39.0 29.0 40.0 31 35.489 38.0 35.0 39.0 29.0 40.0 32 35.101 38.0 34.0 39.0 28.0 40.0 33 34.96975 38.0 33.0 39.0 28.0 40.0 34 34.79375 38.0 33.0 39.0 27.0 40.0 35 34.887 38.0 33.0 39.0 27.0 40.0 36 34.603 38.0 33.0 39.0 27.0 40.0 37 33.88575 37.0 33.0 39.0 25.0 40.0 38 34.17225 37.0 33.0 39.0 25.0 40.0 39 34.21525 37.0 33.0 39.0 26.0 40.0 40 33.768 36.0 33.0 39.0 25.0 40.0 41 33.629 37.0 33.0 39.0 23.0 40.0 42 33.60925 36.0 33.0 39.0 25.0 40.0 43 33.5815 36.0 33.0 39.0 24.0 40.0 44 33.0625 36.0 32.0 39.0 23.0 40.0 45 33.18 36.0 32.0 39.0 23.0 40.0 46 33.20925 36.0 32.0 39.0 23.0 40.0 47 33.0005 36.0 32.0 39.0 23.0 40.0 48 33.0105 36.0 32.0 39.0 23.0 40.0 49 32.75025 36.0 31.0 39.0 23.0 40.0 50 32.57075 35.0 31.0 38.0 23.0 40.0 51 32.52675 36.0 31.0 38.0 23.0 40.0 52 32.142 35.0 31.0 38.0 20.0 39.0 53 32.05275 35.0 31.0 38.0 20.0 39.0 54 31.48225 35.0 30.0 38.0 18.0 39.0 55 31.41925 35.0 30.0 38.0 18.0 39.0 56 30.99825 35.0 30.0 38.0 11.0 39.0 57 30.36375 34.0 29.0 37.0 8.0 39.0 58 30.25325 34.0 29.0 37.0 5.0 39.0 59 30.1495 34.0 29.0 37.0 2.0 39.0 60 29.7055 34.0 28.0 37.0 2.0 39.0 61 29.40275 34.0 28.0 37.0 2.0 39.0 62 29.1835 33.0 28.0 37.0 2.0 39.0 63 28.87175 33.0 27.0 36.0 2.0 39.0 64 28.79025 33.0 27.0 36.0 2.0 39.0 65 28.477 33.0 27.0 36.0 2.0 39.0 66 28.23275 33.0 27.0 36.0 2.0 39.0 67 27.70875 33.0 26.0 36.0 2.0 39.0 68 27.7815 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 3.0 6 2.0 7 3.0 8 5.0 9 11.0 10 6.0 11 11.0 12 16.0 13 12.0 14 11.0 15 14.0 16 18.0 17 17.0 18 21.0 19 26.0 20 27.0 21 23.0 22 20.0 23 27.0 24 50.0 25 47.0 26 58.0 27 65.0 28 73.0 29 95.0 30 127.0 31 125.0 32 144.0 33 194.0 34 271.0 35 376.0 36 508.0 37 649.0 38 664.0 39 271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.708742756361804 15.595867976820358 16.225749559082892 44.46963970773495 2 19.5 24.349999999999998 37.425000000000004 18.725 3 21.725 28.175 28.175 21.925 4 23.200000000000003 34.300000000000004 21.175 21.325 5 25.575 33.550000000000004 22.2 18.675 6 17.8 37.55 24.975 19.675 7 16.05 18.15 44.125 21.675 8 19.075 22.8 29.025000000000002 29.099999999999998 9 19.7 23.225 32.425 24.65 10 21.0 36.975 23.95 18.075 11 25.35 27.650000000000002 21.099999999999998 25.900000000000002 12 21.375 24.8 29.549999999999997 24.275 13 19.7 27.175 32.35 20.775 14 21.075 27.275 28.799999999999997 22.85 15 21.2 28.7 26.825 23.275000000000002 16 21.325 27.900000000000002 28.4 22.375 17 22.15 28.575 27.474999999999998 21.8 18 21.475 28.425 27.375 22.725 19 22.25 27.625 27.800000000000004 22.325 20 22.475 27.200000000000003 27.275 23.05 21 21.5 28.775000000000002 27.224999999999998 22.5 22 21.05 28.65 26.950000000000003 23.35 23 20.775 29.725 26.724999999999998 22.775000000000002 24 20.9 29.575000000000003 28.299999999999997 21.224999999999998 25 21.95 28.575 27.400000000000002 22.075 26 22.125 27.3 28.125 22.45 27 21.575 28.775000000000002 27.675 21.975 28 20.549999999999997 28.525 28.349999999999998 22.575 29 21.775 29.349999999999998 26.400000000000002 22.475 30 21.325 28.925 27.35 22.400000000000002 31 20.375 28.249999999999996 27.975 23.400000000000002 32 21.275 28.525 28.825 21.375 33 22.175 28.299999999999997 27.025 22.5 34 22.0 28.425 27.35 22.225 35 21.075 28.325 28.725 21.875 36 21.3 28.025 27.1 23.575 37 22.35 28.799999999999997 27.500000000000004 21.349999999999998 38 22.675 29.299999999999997 27.3 20.724999999999998 39 22.6 28.449999999999996 27.3 21.65 40 21.7 29.225 26.724999999999998 22.35 41 21.825 28.825 27.975 21.375 42 22.5 27.800000000000004 27.325 22.375 43 21.375 27.825 27.275 23.525 44 23.125 28.050000000000004 28.075 20.75 45 22.525000000000002 27.325 28.225 21.925 46 22.575 27.224999999999998 27.450000000000003 22.75 47 21.725 27.575 29.225 21.475 48 22.15 28.575 28.349999999999998 20.925 49 21.8 27.900000000000002 28.175 22.125 50 22.825 28.325 26.55 22.3 51 23.275000000000002 27.800000000000004 27.625 21.3 52 20.1 28.525 28.65 22.725 53 22.725 28.375 28.075 20.825 54 22.400000000000002 29.075 26.974999999999998 21.55 55 22.7 27.0 28.349999999999998 21.95 56 23.0 28.075 27.650000000000002 21.275 57 21.025 29.175 27.175 22.625 58 20.75 28.349999999999998 29.7 21.2 59 23.150000000000002 27.325 28.1 21.425 60 21.55 30.075000000000003 27.150000000000002 21.224999999999998 61 22.825 27.825 28.4 20.95 62 23.25 28.249999999999996 26.275 22.225 63 22.525000000000002 26.6 29.175 21.7 64 22.525000000000002 28.1 28.575 20.8 65 22.875 29.049999999999997 26.6 21.475 66 21.95 28.15 27.800000000000004 22.1 67 20.349999999999998 28.375 26.974999999999998 24.3 68 22.075 29.575000000000003 26.5 21.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.5 19 3.0 20 2.0 21 2.5 22 4.0 23 6.0 24 6.0 25 4.0 26 13.0 27 22.0 28 22.0 29 27.0 30 38.5 31 45.0 32 55.5 33 83.5 34 101.0 35 113.5 36 165.5 37 205.0 38 225.5 39 261.0 40 302.5 41 329.0 42 345.0 43 360.0 44 359.0 45 344.5 46 340.0 47 350.0 48 306.0 49 237.5 50 213.0 51 194.0 52 153.0 53 131.0 54 112.0 55 92.0 56 91.0 57 65.0 58 32.5 59 26.0 60 23.0 61 17.5 62 15.0 63 11.5 64 7.5 65 8.5 66 10.0 67 6.5 68 2.0 69 1.0 70 3.0 71 5.0 72 5.0 73 3.0 74 0.5 75 0.0 76 0.5 77 1.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315103 spots for SRR3207705.sra Written 315103 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra Read 315091 spots for SRR3207705.sra Written 315091 spots for SRR3207705.sra SRR ids: ['SRR3207705.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yqztjrg6 SRR3207705.sra spots: 6301832 blocks: [[1, 315091], [315092, 630182], [630183, 945273], [945274, 1260364], [1260365, 1575455], [1575456, 1890546], [1890547, 2205637], [2205638, 2520728], [2520729, 2835819], [2835820, 3150910], [3150911, 3466001], [3466002, 3781092], [3781093, 4096183], [4096184, 4411274], [4411275, 4726365], [4726366, 5041456], [5041457, 5356547], [5356548, 5671638], [5671639, 5986729], [5986730, 6301832]] SRR3207705 file size 1323136 SRR3207705 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207705 SRR3207705_1.fastq Input file: SRR3207705_1.fastq trimmed: SRR3207705-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:42:48 2025 >> started Mon Feb 10 14:42:51 2025 >> done (3.007s) 6301832 reads processed; of these: 14126 ( 0.22%) short reads filtered out after trimming by size control 15563 ( 0.25%) empty reads filtered out after trimming by size control 6272143 (99.53%) reads available; of these: 511105 ( 8.15%) trimmed reads available after processing 5761038 (91.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1656 0.03% 19 2607 0.04% 20 4179 0.07% 21 1346 0.02% 22 1994 0.03% 23 2788 0.04% 24 5018 0.08% 25 8042 0.13% 26 2114 0.03% 27 2858 0.05% 28 3799 0.06% 29 5856 0.09% 30 9202 0.15% 31 2384 0.04% 32 2958 0.05% 33 3958 0.06% 34 6029 0.10% 35 9026 0.14% 36 2245 0.04% 37 3019 0.05% 38 4160 0.07% 39 6300 0.10% 40 9617 0.15% 41 2416 0.04% 42 3402 0.05% 43 5460 0.09% 44 8327 0.13% 45 12945 0.21% 46 3003 0.05% 47 4280 0.07% 48 6593 0.11% 49 11584 0.18% 50 18864 0.30% 51 4671 0.07% 52 6467 0.10% 53 10752 0.17% 54 17620 0.28% 55 31329 0.50% 56 6462 0.10% 57 9376 0.15% 58 13985 0.22% 59 24198 0.39% 60 43775 0.70% 61 8754 0.14% 62 12514 0.20% 63 19629 0.31% 64 33880 0.54% 65 57601 0.92% 66 12153 0.19% 67 19910 0.32% 68 5761038 91.85% 6272143 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=38 prefix-density=0.00 prefix-fanout=1.0 sequence=GTACTGGATGCATCTGCAGGATATCGCGGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=4 fanout-score=100.25 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=16.1 sequence=AAGAAGAAGAAA Started job on | Feb 10 14:43:04 Started mapping on | Feb 10 14:43:04 Finished on | Feb 10 14:43:11 Mapping speed, Million of reads per hour | 3225.67 Number of input reads | 6272143 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5853315 Uniquely mapped reads % | 93.32% Average mapped length | 66.74 Number of splices: Total | 1077633 Number of splices: Annotated (sjdb) | 1059832 Number of splices: GT/AG | 1060737 Number of splices: GC/AG | 14095 Number of splices: AT/AC | 1403 Number of splices: Non-canonical | 1398 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210450 % of reads mapped to multiple loci | 3.36% Number of reads mapped to too many loci | 179029 % of reads mapped to too many loci | 2.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 208378 208378 208378 N_multimapping 210450 210450 210450 N_noFeature 280857 3026416 3070044 N_ambiguous 56171 9079 9435 UnstrandedReadsAssigned:5516287 PositiveStrandReadsAssigned:2817820 NegativeStrandReadsAssigned:2773836 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207705 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207705-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,272,143 reads, 5,778,133 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR3207705.ke.tsv 34699 SRR3207705.se.tsv 87100 total ==> SRR3207705.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 177 23.6958 Potri.005G024800.1.v4.1 1035 936 47 12.9002 Potri.004G059700.1.v4.1 961 862 20 5.96068 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 100.109 9.04309 Potri.016G087400.1.v4.1 270 171 189 283.948 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 32 4.91098 Potri.012G127500.1.v4.1 977 878 1003 293.481 ==> SRR3207705.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 736 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 106 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207705 completed mapping pipeline successfully