Starting /dee2/code/volunteer_pipeline.sh SRR3207706 current disk space = 3059055558656 free memory = 1127892640 SRR3207706 SRAfilesize 1dcf3120b1775dbd995d5917b2403da4 SRR3207706.sra SRR3207706.sra file validated SRR3207706 is single end SRR3207706 is conventional basespace SRR3207706 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207706_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.48675 39.0 38.0 40.0 33.0 40.0 2 37.14725 39.0 36.0 40.0 33.0 40.0 3 37.007 39.0 36.0 40.0 33.0 40.0 4 37.012 39.0 36.0 40.0 33.0 40.0 5 37.02775 39.0 36.0 40.0 33.0 40.0 6 37.18675 39.0 36.0 40.0 33.0 40.0 7 37.22 39.0 36.0 40.0 33.0 40.0 8 36.8735 39.0 36.0 40.0 31.0 40.0 9 37.09575 39.0 36.0 40.0 33.0 40.0 10 36.94 39.0 36.0 40.0 32.0 40.0 11 36.80975 39.0 36.0 40.0 32.0 40.0 12 36.75775 39.0 36.0 40.0 31.0 40.0 13 36.82525 39.0 36.0 40.0 31.0 40.0 14 36.8555 39.0 36.0 40.0 31.0 40.0 15 36.746 39.0 36.0 40.0 31.0 40.0 16 36.67025 39.0 36.0 40.0 31.0 40.0 17 36.5615 38.0 35.0 40.0 30.0 40.0 18 36.63825 38.0 35.0 40.0 31.0 40.0 19 36.40725 38.0 35.0 40.0 30.0 40.0 20 36.52975 38.0 35.0 40.0 31.0 40.0 21 36.53525 38.0 35.0 40.0 31.0 40.0 22 36.232 38.0 35.0 40.0 30.0 40.0 23 36.27975 38.0 35.0 40.0 30.0 40.0 24 36.435 38.0 35.0 40.0 31.0 40.0 25 36.3055 38.0 35.0 40.0 30.0 40.0 26 36.19075 38.0 35.0 39.0 30.0 40.0 27 35.81025 38.0 35.0 39.0 29.0 40.0 28 35.60175 38.0 35.0 39.0 29.0 40.0 29 35.72675 38.0 35.0 39.0 29.0 40.0 30 35.74575 38.0 35.0 39.0 29.0 40.0 31 35.45175 38.0 35.0 39.0 29.0 40.0 32 35.175 38.0 34.0 39.0 28.0 40.0 33 35.11625 38.0 34.0 39.0 28.0 40.0 34 34.7335 38.0 33.0 39.0 27.0 40.0 35 35.0325 38.0 33.0 39.0 28.0 40.0 36 34.71975 38.0 33.0 39.0 27.0 40.0 37 34.134 37.0 33.0 39.0 25.0 40.0 38 34.33025 37.0 33.0 39.0 26.0 40.0 39 34.31325 37.0 33.0 39.0 26.0 40.0 40 33.97675 37.0 33.0 39.0 25.0 40.0 41 33.9905 37.0 33.0 39.0 25.0 40.0 42 33.8615 37.0 33.0 39.0 26.0 40.0 43 33.6595 37.0 33.0 39.0 23.0 40.0 44 33.3565 36.0 32.0 39.0 23.0 40.0 45 33.50175 36.0 32.0 39.0 23.0 40.0 46 33.4445 36.0 33.0 39.0 23.0 40.0 47 33.117 36.0 32.0 39.0 23.0 40.0 48 33.1355 36.0 32.0 39.0 23.0 40.0 49 32.95975 36.0 32.0 39.0 23.0 40.0 50 32.81425 36.0 32.0 39.0 23.0 40.0 51 32.7505 36.0 32.0 39.0 23.0 40.0 52 32.311 36.0 31.0 38.0 21.0 40.0 53 32.1945 35.0 31.0 38.0 20.0 40.0 54 31.6115 35.0 30.0 38.0 18.0 39.0 55 31.48575 35.0 30.0 38.0 17.0 39.0 56 31.09425 35.0 30.0 38.0 12.0 39.0 57 30.71875 35.0 29.0 38.0 10.0 39.0 58 30.45125 34.0 29.0 38.0 8.0 39.0 59 30.40175 34.0 29.0 38.0 2.0 39.0 60 29.87675 34.0 29.0 37.0 2.0 39.0 61 29.7 34.0 29.0 38.0 2.0 39.0 62 29.44975 34.0 28.0 37.0 2.0 39.0 63 29.10175 33.0 27.0 37.0 2.0 39.0 64 28.97675 33.0 27.0 37.0 2.0 39.0 65 28.7595 33.0 27.0 37.0 2.0 39.0 66 28.493 33.0 27.0 37.0 2.0 39.0 67 27.8995 33.0 26.0 36.0 2.0 39.0 68 27.863 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 2.0 5 2.0 6 2.0 7 3.0 8 4.0 9 4.0 10 11.0 11 11.0 12 10.0 13 10.0 14 20.0 15 20.0 16 31.0 17 17.0 18 13.0 19 18.0 20 20.0 21 29.0 22 25.0 23 40.0 24 43.0 25 59.0 26 44.0 27 67.0 28 64.0 29 94.0 30 105.0 31 116.0 32 143.0 33 193.0 34 270.0 35 380.0 36 476.0 37 607.0 38 723.0 39 318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.830188679245282 15.29559748427673 17.91194968553459 45.96226415094339 2 19.650000000000002 24.85 37.475 18.025 3 23.3 27.800000000000004 27.075 21.825 4 24.4 33.050000000000004 20.95 21.6 5 25.174999999999997 36.3 22.725 15.8 6 17.75443860965241 38.40960240060015 24.18104526131533 19.654913728432106 7 15.024999999999999 16.875 46.75 21.349999999999998 8 19.05 23.400000000000002 30.375000000000004 27.175 9 19.950000000000003 23.375 31.075000000000003 25.6 10 19.725 38.775 24.375 17.125 11 25.75 27.450000000000003 21.55 25.25 12 20.474999999999998 25.4 29.075 25.05 13 18.6 28.199999999999996 32.725 20.474999999999998 14 20.974999999999998 28.025 30.625000000000004 20.375 15 19.725 28.749999999999996 29.2 22.325 16 20.349999999999998 28.349999999999998 29.4 21.9 17 22.025 28.449999999999996 27.175 22.35 18 22.2 28.95 27.05 21.8 19 21.825 29.325000000000003 26.950000000000003 21.9 20 20.549999999999997 28.225 28.125 23.1 21 21.2 27.925 28.549999999999997 22.325 22 19.950000000000003 28.525 28.675 22.85 23 20.599999999999998 29.825000000000003 28.449999999999996 21.125 24 21.5 28.575 26.75 23.175 25 20.125 28.849999999999998 28.65 22.375 26 21.405351337834457 29.982495623905976 27.156789197299325 21.45536384096024 27 20.655163790947736 29.40735183795949 27.806951737934483 22.13053263315829 28 21.080270067516878 29.48237059264816 27.306826706676667 22.13053263315829 29 22.650000000000002 28.050000000000004 26.224999999999998 23.075000000000003 30 21.85546386596649 28.157039259814955 28.432108027006752 21.555388847211805 31 21.13028257064266 27.70692673168292 27.68192048012003 23.48087021755439 32 20.849999999999998 29.875 27.900000000000002 21.375 33 21.45536384096024 29.607401850462615 26.331582895723933 22.605651412853213 34 20.1 27.650000000000002 27.750000000000004 24.5 35 21.875 28.1 28.525 21.5 36 22.175 28.849999999999998 27.675 21.3 37 21.8 28.7 27.3 22.2 38 21.375 28.449999999999996 28.325 21.85 39 20.155038759689923 29.107276819204802 27.581895473868467 23.15578894723681 40 22.575 28.525 27.525 21.375 41 22.05551387846962 28.80720180045011 28.532133033258315 20.605151287821954 42 22.18054513628407 27.906976744186046 28.507126781695426 21.405351337834457 43 22.005501375343837 27.7569392348087 27.306826706676667 22.930732683170792 44 21.475 27.200000000000003 28.799999999999997 22.525000000000002 45 21.10527631907977 28.60715178794699 28.182045511377847 22.1055263815954 46 22.15 28.199999999999996 28.65 21.0 47 22.175 28.599999999999998 27.025 22.2 48 21.405351337834457 28.582145536384097 28.28207051762941 21.73043260815204 49 22.7 28.599999999999998 27.3 21.4 50 22.45 28.1 27.925 21.525 51 21.2 28.375 27.55 22.875 52 20.355088772193046 28.457114278569644 27.68192048012003 23.50587646911728 53 22.655663915978995 29.03225806451613 26.60665166291573 21.705426356589147 54 21.725 27.55 28.749999999999996 21.975 55 20.95 28.675 28.15 22.225 56 22.35 27.85 27.875 21.925 57 22.225 28.4 26.700000000000003 22.675 58 21.224999999999998 28.499999999999996 28.349999999999998 21.925 59 23.125 27.800000000000004 28.1 20.974999999999998 60 21.5 27.650000000000002 28.375 22.475 61 22.0 28.499999999999996 28.499999999999996 21.0 62 21.25 27.175 28.925 22.650000000000002 63 21.15 28.799999999999997 27.750000000000004 22.3 64 20.525 29.7 29.375 20.4 65 23.875 28.000000000000004 26.375 21.75 66 21.575 29.45 27.825 21.15 67 21.025 29.4 29.5 20.075000000000003 68 22.650000000000002 27.925 28.625 20.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 2.0 18 2.5 19 2.0 20 2.5 21 4.0 22 5.0 23 5.5 24 10.0 25 14.0 26 16.0 27 19.5 28 21.0 29 34.0 30 54.0 31 61.0 32 65.5 33 92.0 34 114.0 35 142.0 36 185.5 37 201.0 38 227.0 39 271.5 40 298.0 41 306.0 42 316.0 43 338.0 44 350.0 45 370.0 46 346.5 47 303.0 48 275.0 49 227.5 50 208.0 51 194.5 52 150.5 53 120.0 54 106.0 55 74.0 56 56.0 57 50.0 58 38.5 59 33.0 60 26.5 61 17.5 62 15.0 63 12.0 64 6.0 65 4.0 66 5.0 67 3.0 68 1.0 69 1.0 70 2.0 71 2.5 72 2.0 73 1.0 74 1.0 75 2.0 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.025 27 0.025 28 0.025 29 0.0 30 0.025 31 0.025 32 0.0 33 0.025 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.0 41 0.025 42 0.025 43 0.025 44 0.0 45 0.025 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.528169014084507 1.05 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.15 0.0 0.0 0.0 0.0 23 0.15 0.0 0.0 0.0 0.0 24 0.15 0.0 0.0 0.0 0.0 25 0.15 0.0 0.0 0.0 0.0 26 0.15 0.0 0.0 0.0 0.0 27 0.15 0.0 0.0 0.0 0.0 28 0.15 0.0 0.0 0.0 0.0 29 0.15 0.0 0.0 0.0 0.0 30 0.15 0.0 0.0 0.0 0.0 31 0.15 0.0 0.0 0.0 0.0 32 0.15 0.0 0.0 0.0 0.0 33 0.15 0.0 0.0 0.0 0.0 34 0.15 0.0 0.0 0.0 0.0 35 0.15 0.0 0.0 0.0 0.0 36 0.15 0.0 0.0 0.0 0.0 37 0.15 0.0 0.0 0.0 0.0 38 0.15 0.0 0.0 0.0 0.0 39 0.15 0.0 0.0 0.0 0.0 40 0.15 0.0 0.0 0.0 0.0 41 0.15 0.0 0.0 0.0 0.0 42 0.15 0.0 0.0 0.0 0.0 43 0.15 0.0 0.0 0.0 0.0 44 0.15 0.0 0.0 0.0 0.0 45 0.15 0.0 0.0 0.0 0.0 46 0.15 0.0 0.0 0.0 0.0 47 0.15 0.0 0.0 0.0 0.0 48 0.15 0.0 0.0 0.0 0.0 49 0.15 0.0 0.0 0.0 0.0 50 0.15 0.0 0.0 0.0 0.0 51 0.15 0.0 0.0 0.0 0.0 52 0.15 0.0 0.0 0.0 0.0 53 0.15 0.0 0.0 0.0 0.0 54 0.15 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251083 spots for SRR3207706.sra Written 251083 spots for SRR3207706.sra Read 251092 spots for SRR3207706.sra Written 251092 spots for SRR3207706.sra SRR ids: ['SRR3207706.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fnlqvm90 SRR3207706.sra spots: 5021669 blocks: [[1, 251083], [251084, 502166], [502167, 753249], [753250, 1004332], [1004333, 1255415], [1255416, 1506498], [1506499, 1757581], [1757582, 2008664], [2008665, 2259747], [2259748, 2510830], [2510831, 2761913], [2761914, 3012996], [3012997, 3264079], [3264080, 3515162], [3515163, 3766245], [3766246, 4017328], [4017329, 4268411], [4268412, 4519494], [4519495, 4770577], [4770578, 5021669]] SRR3207706 file size 1054136 SRR3207706 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207706 SRR3207706_1.fastq Input file: SRR3207706_1.fastq trimmed: SRR3207706-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 14:38:38 2025 >> started Mon Feb 10 14:38:41 2025 >> done (2.514s) 5021669 reads processed; of these: 11376 ( 0.23%) short reads filtered out after trimming by size control 12226 ( 0.24%) empty reads filtered out after trimming by size control 4998067 (99.53%) reads available; of these: 390758 ( 7.82%) trimmed reads available after processing 4607309 (92.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1375 0.03% 19 2074 0.04% 20 3257 0.07% 21 1080 0.02% 22 1480 0.03% 23 2185 0.04% 24 3953 0.08% 25 6292 0.13% 26 1722 0.03% 27 2260 0.05% 28 3035 0.06% 29 4670 0.09% 30 7260 0.15% 31 1840 0.04% 32 2423 0.05% 33 3036 0.06% 34 4722 0.09% 35 7080 0.14% 36 1846 0.04% 37 2291 0.05% 38 3203 0.06% 39 5009 0.10% 40 7613 0.15% 41 1795 0.04% 42 2663 0.05% 43 4155 0.08% 44 6488 0.13% 45 10119 0.20% 46 2330 0.05% 47 3114 0.06% 48 4923 0.10% 49 8778 0.18% 50 14577 0.29% 51 3278 0.07% 52 5044 0.10% 53 8028 0.16% 54 13348 0.27% 55 24144 0.48% 56 4827 0.10% 57 7121 0.14% 58 10668 0.21% 59 18469 0.37% 60 33132 0.66% 61 6542 0.13% 62 9262 0.19% 63 15018 0.30% 64 25414 0.51% 65 43615 0.87% 66 9039 0.18% 67 15161 0.30% 68 4607309 92.18% 4998067 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=29 prefix-density=0.03 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=170.85 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=19.7 sequence=TTCTTCTTCTTC Started job on | Feb 10 14:38:58 Started mapping on | Feb 10 14:38:59 Finished on | Feb 10 14:39:06 Mapping speed, Million of reads per hour | 2570.43 Number of input reads | 4998067 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4658679 Uniquely mapped reads % | 93.21% Average mapped length | 66.76 Number of splices: Total | 849755 Number of splices: Annotated (sjdb) | 835133 Number of splices: GT/AG | 836481 Number of splices: GC/AG | 10915 Number of splices: AT/AC | 1132 Number of splices: Non-canonical | 1227 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166688 % of reads mapped to multiple loci | 3.34% Number of reads mapped to too many loci | 149657 % of reads mapped to too many loci | 2.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 172700 172700 172700 N_multimapping 166688 166688 166688 N_noFeature 236155 2413252 2451290 N_ambiguous 45508 7623 7629 UnstrandedReadsAssigned:4377016 PositiveStrandReadsAssigned:2237804 NegativeStrandReadsAssigned:2199760 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207706 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207706-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,998,067 reads, 4,588,986 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 970 rounds 52401 SRR3207706.ke.tsv 34699 SRR3207706.se.tsv 87100 total ==> SRR3207706.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 165 27.3838 Potri.005G024800.1.v4.1 1035 936 53.0166 18.0393 Potri.004G059700.1.v4.1 961 862 18 6.65043 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 97.848 10.9574 Potri.016G087400.1.v4.1 270 171 171 318.482 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18 3.42454 Potri.012G127500.1.v4.1 977 878 794 288.012 ==> SRR3207706.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 532 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 92 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207706 completed mapping pipeline successfully