Starting /dee2/code/volunteer_pipeline.sh SRR3207707 current disk space = 3058738589696 free memory = 1561590056 SRR3207707 SRAfilesize f4eab7bd372cc055823f54dedd4a792d SRR3207707.sra SRR3207707.sra file validated SRR3207707 is single end SRR3207707 is conventional basespace SRR3207707 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207707_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.84325 38.0 36.0 39.0 33.0 40.0 2 36.44175 38.0 35.0 39.0 30.0 40.0 3 36.2835 38.0 35.0 39.0 30.0 40.0 4 36.256 38.0 35.0 39.0 30.0 40.0 5 36.20725 38.0 35.0 39.0 30.0 40.0 6 36.25375 38.0 35.0 39.0 30.0 40.0 7 36.2515 38.0 35.0 39.0 30.0 40.0 8 35.95675 38.0 35.0 39.0 29.0 40.0 9 35.8165 38.0 35.0 39.0 29.0 40.0 10 35.82025 38.0 35.0 39.0 29.0 40.0 11 36.1955 38.0 35.0 39.0 30.0 40.0 12 35.91275 38.0 35.0 39.0 29.0 40.0 13 35.8925 38.0 35.0 39.0 29.0 40.0 14 35.729 38.0 35.0 39.0 29.0 40.0 15 35.82425 38.0 35.0 39.0 29.0 40.0 16 35.93925 38.0 35.0 39.0 29.0 40.0 17 35.9065 38.0 35.0 39.0 29.0 40.0 18 35.59175 38.0 34.0 39.0 28.0 40.0 19 35.84125 38.0 35.0 39.0 29.0 40.0 20 35.6085 38.0 34.0 39.0 29.0 40.0 21 35.3945 38.0 34.0 39.0 28.0 40.0 22 35.67175 38.0 35.0 39.0 29.0 40.0 23 35.50725 38.0 34.0 39.0 29.0 40.0 24 35.733 38.0 35.0 39.0 29.0 40.0 25 35.5445 38.0 35.0 39.0 29.0 40.0 26 35.5155 38.0 35.0 39.0 29.0 40.0 27 35.08575 38.0 33.0 39.0 28.0 40.0 28 34.9125 38.0 33.0 39.0 27.0 40.0 29 34.8335 38.0 33.0 39.0 27.0 40.0 30 34.689 38.0 33.0 39.0 27.0 40.0 31 34.51925 38.0 33.0 39.0 26.0 40.0 32 34.14725 37.0 33.0 39.0 25.0 40.0 33 33.96725 37.0 33.0 39.0 25.0 40.0 34 33.9525 37.0 33.0 39.0 25.0 40.0 35 33.65475 36.0 32.0 39.0 23.0 40.0 36 33.72975 36.0 33.0 39.0 23.0 40.0 37 33.539 36.0 32.0 39.0 24.0 40.0 38 33.292 36.0 32.0 39.0 23.0 40.0 39 33.0585 36.0 31.0 39.0 23.0 40.0 40 33.04975 36.0 31.0 39.0 23.0 40.0 41 33.02975 36.0 31.0 39.0 23.0 40.0 42 32.99225 36.0 31.0 39.0 23.0 40.0 43 32.9375 36.0 31.0 39.0 23.0 40.0 44 32.834 36.0 31.0 38.0 23.0 40.0 45 32.6065 35.0 31.0 38.0 23.0 40.0 46 32.58725 36.0 31.0 39.0 21.0 40.0 47 32.37325 36.0 31.0 38.0 21.0 39.0 48 32.34625 36.0 31.0 38.0 20.0 39.0 49 32.08875 35.0 30.0 38.0 21.0 39.0 50 32.25175 35.0 31.0 38.0 22.0 39.0 51 31.85 35.0 30.0 38.0 18.0 39.0 52 31.68575 35.0 30.0 38.0 18.0 39.0 53 31.08075 35.0 29.0 38.0 16.0 39.0 54 31.03425 35.0 29.0 38.0 15.0 39.0 55 30.79225 35.0 29.0 38.0 10.0 39.0 56 30.32675 35.0 29.0 38.0 2.0 39.0 57 29.76025 34.0 28.0 37.0 2.0 39.0 58 29.69225 34.0 28.0 37.0 2.0 39.0 59 29.50275 33.0 28.0 37.0 2.0 39.0 60 29.02075 33.0 27.0 37.0 2.0 39.0 61 28.958 33.0 27.0 37.0 2.0 39.0 62 28.38575 33.0 27.0 36.0 2.0 39.0 63 28.326 33.0 27.0 36.0 2.0 39.0 64 28.256 33.0 27.0 36.0 2.0 39.0 65 27.4535 33.0 25.0 36.0 2.0 38.0 66 27.50625 33.0 25.0 36.0 2.0 39.0 67 27.11575 33.0 23.0 36.0 2.0 38.0 68 26.71325 32.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 5.0 6 4.0 7 4.0 8 8.0 9 9.0 10 9.0 11 7.0 12 14.0 13 16.0 14 19.0 15 19.0 16 17.0 17 13.0 18 24.0 19 27.0 20 30.0 21 44.0 22 44.0 23 43.0 24 53.0 25 63.0 26 65.0 27 87.0 28 99.0 29 100.0 30 113.0 31 144.0 32 200.0 33 218.0 34 289.0 35 373.0 36 492.0 37 548.0 38 587.0 39 200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.37547312641938 16.502649507948526 16.70451678021701 42.41736058541509 2 18.575 26.575 37.824999999999996 17.025000000000002 3 20.849999999999998 30.599999999999998 25.85 22.7 4 23.375 35.875 20.150000000000002 20.599999999999998 5 24.375 37.2 22.125 16.3 6 16.675 39.225 24.099999999999998 20.0 7 14.975 17.25 47.05 20.724999999999998 8 19.225 23.474999999999998 30.0 27.3 9 19.325 22.625 31.4 26.650000000000002 10 18.7 39.225 24.425 17.65 11 25.4 29.5 19.925 25.174999999999997 12 20.575 23.95 30.099999999999998 25.374999999999996 13 18.0 28.349999999999998 32.7 20.95 14 19.6 27.375 29.725 23.3 15 20.5 29.375 28.375 21.75 16 21.9 27.85 27.325 22.925 17 21.6 28.799999999999997 27.575 22.025 18 20.05 29.175 28.449999999999996 22.325 19 20.575 28.375 28.249999999999996 22.8 20 21.775 30.275000000000002 26.674999999999997 21.275 21 20.849999999999998 28.375 29.049999999999997 21.725 22 21.275 28.4 28.749999999999996 21.575 23 21.975 29.549999999999997 28.65 19.825 24 21.725 29.599999999999998 27.450000000000003 21.224999999999998 25 20.75 28.299999999999997 28.799999999999997 22.15 26 21.575 29.375 27.725 21.325 27 21.25 29.349999999999998 28.275 21.125 28 22.175 29.625 26.55 21.65 29 21.775 28.65 27.975 21.6 30 22.425 28.65 27.825 21.099999999999998 31 21.5 28.625 28.249999999999996 21.625 32 21.9 29.5 28.1 20.5 33 21.975 29.65 25.900000000000002 22.475 34 20.65 28.65 27.950000000000003 22.75 35 21.175 31.075000000000003 27.125 20.625 36 21.8 28.95 28.225 21.025 37 21.725 28.925 28.249999999999996 21.099999999999998 38 22.35 28.9 28.249999999999996 20.5 39 22.125 28.675 26.625 22.575 40 21.2 28.299999999999997 28.375 22.125 41 21.975 29.599999999999998 27.975 20.45 42 21.875 28.449999999999996 28.549999999999997 21.125 43 21.375 28.9 28.925 20.8 44 20.599999999999998 30.3 28.7 20.4 45 22.175 28.625 28.075 21.125 46 21.45 28.425 27.800000000000004 22.325 47 20.45 29.575000000000003 28.199999999999996 21.775 48 20.575 29.849999999999998 27.400000000000002 22.175 49 21.675 27.425 29.049999999999997 21.85 50 22.0 28.575 28.799999999999997 20.625 51 20.474999999999998 29.325000000000003 28.799999999999997 21.4 52 21.55 29.225 28.625 20.599999999999998 53 21.9 28.125 29.025000000000002 20.95 54 21.099999999999998 29.025000000000002 28.375 21.5 55 22.475 28.249999999999996 28.549999999999997 20.724999999999998 56 22.5 28.525 28.025 20.95 57 21.875 28.125 28.625 21.375 58 20.775 28.975 28.65 21.6 59 21.375 29.175 27.575 21.875 60 22.5 28.925 27.275 21.3 61 21.525 28.325 28.975 21.175 62 21.3 28.799999999999997 28.599999999999998 21.3 63 22.075 28.575 27.825 21.525 64 21.2 29.4 28.625 20.775 65 21.4 29.225 27.900000000000002 21.475 66 22.075 29.075 28.299999999999997 20.549999999999997 67 21.925 29.325000000000003 27.950000000000003 20.8 68 21.025 30.0 28.249999999999996 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 5.0 22 7.0 23 10.0 24 16.0 25 19.0 26 23.5 27 36.0 28 44.0 29 46.0 30 58.5 31 69.0 32 83.5 33 108.5 34 119.0 35 141.0 36 184.0 37 205.0 38 224.0 39 287.0 40 329.0 41 327.0 42 337.0 43 357.0 44 367.0 45 329.5 46 286.5 47 281.0 48 273.0 49 233.0 50 201.0 51 172.0 52 136.5 53 130.0 54 105.5 55 72.5 56 64.0 57 51.0 58 31.0 59 24.0 60 23.5 61 14.5 62 6.0 63 6.5 64 5.0 65 3.5 66 4.0 67 3.0 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309303 spots for SRR3207707.sra Written 309303 spots for SRR3207707.sra Read 309314 spots for SRR3207707.sra Written 309314 spots for SRR3207707.sra SRR ids: ['SRR3207707.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ja4zlhj5 SRR3207707.sra spots: 6186071 blocks: [[1, 309303], [309304, 618606], [618607, 927909], [927910, 1237212], [1237213, 1546515], [1546516, 1855818], [1855819, 2165121], [2165122, 2474424], [2474425, 2783727], [2783728, 3093030], [3093031, 3402333], [3402334, 3711636], [3711637, 4020939], [4020940, 4330242], [4330243, 4639545], [4639546, 4948848], [4948849, 5258151], [5258152, 5567454], [5567455, 5876757], [5876758, 6186071]] SRR3207707 file size 1298807 SRR3207707 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207707 SRR3207707_1.fastq Input file: SRR3207707_1.fastq trimmed: SRR3207707-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:50:01 2025 >> started Mon Feb 10 15:50:04 2025 >> done (3.033s) 6186071 reads processed; of these: 16478 ( 0.27%) short reads filtered out after trimming by size control 10379 ( 0.17%) empty reads filtered out after trimming by size control 6159214 (99.57%) reads available; of these: 545768 ( 8.86%) trimmed reads available after processing 5613446 (91.14%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1875 0.03% 19 2840 0.05% 20 4270 0.07% 21 1373 0.02% 22 2057 0.03% 23 3054 0.05% 24 5079 0.08% 25 8641 0.14% 26 2301 0.04% 27 2999 0.05% 28 3892 0.06% 29 5857 0.10% 30 10310 0.17% 31 2486 0.04% 32 3409 0.06% 33 4456 0.07% 34 6507 0.11% 35 10069 0.16% 36 2439 0.04% 37 3383 0.05% 38 4568 0.07% 39 6909 0.11% 40 10303 0.17% 41 2465 0.04% 42 3574 0.06% 43 5038 0.08% 44 8022 0.13% 45 12385 0.20% 46 3043 0.05% 47 4424 0.07% 48 6819 0.11% 49 11994 0.19% 50 18940 0.31% 51 4739 0.08% 52 7188 0.12% 53 11234 0.18% 54 18374 0.30% 55 33486 0.54% 56 6897 0.11% 57 10067 0.16% 58 15474 0.25% 59 26169 0.42% 60 46893 0.76% 61 9627 0.16% 62 13541 0.22% 63 21726 0.35% 64 37926 0.62% 65 62173 1.01% 66 13337 0.22% 67 21136 0.34% 68 5613446 91.14% 6159214 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=107.34 fanout-score-rank=8 prefix-density=0.22 prefix-fanout=17.2 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=189.85 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=20.2 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:50:20 Started mapping on | Feb 10 15:50:20 Finished on | Feb 10 15:50:26 Mapping speed, Million of reads per hour | 3695.53 Number of input reads | 6159214 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5859863 Uniquely mapped reads % | 95.14% Average mapped length | 66.58 Number of splices: Total | 1067336 Number of splices: Annotated (sjdb) | 1049218 Number of splices: GT/AG | 1050604 Number of splices: GC/AG | 13819 Number of splices: AT/AC | 1329 Number of splices: Non-canonical | 1584 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197146 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 73367 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 102205 102205 102205 N_multimapping 197146 197146 197146 N_noFeature 308098 3040853 3089333 N_ambiguous 56305 9293 9291 UnstrandedReadsAssigned:5495460 PositiveStrandReadsAssigned:2809717 NegativeStrandReadsAssigned:2761239 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207707 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207707-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,159,214 reads, 5,644,249 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR3207707.ke.tsv 34699 SRR3207707.se.tsv 87100 total ==> SRR3207707.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 155 21.3488 Potri.005G024800.1.v4.1 1035 936 58 16.3783 Potri.004G059700.1.v4.1 961 862 14 4.29276 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 101.293 9.41386 Potri.016G087400.1.v4.1 270 171 217 335.413 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 28.5141 4.50215 Potri.012G127500.1.v4.1 977 878 971 292.308 ==> SRR3207707.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 845 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 85 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207707 completed mapping pipeline successfully