Starting /dee2/code/volunteer_pipeline.sh SRR3207708 current disk space = 3058847834112 free memory = 1573612248 SRR3207708 SRAfilesize ad5373ef18672f059b927a8fde64ff30 SRR3207708.sra SRR3207708.sra file validated SRR3207708 is single end SRR3207708 is conventional basespace SRR3207708 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207708_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.855 38.0 36.0 39.0 33.0 40.0 2 36.5045 38.0 35.0 39.0 31.0 40.0 3 36.3845 38.0 35.0 39.0 30.0 40.0 4 36.3465 38.0 35.0 39.0 30.0 40.0 5 36.305 38.0 35.0 39.0 30.0 40.0 6 36.34775 38.0 35.0 39.0 31.0 40.0 7 36.416 38.0 35.0 39.0 30.0 40.0 8 36.04525 38.0 35.0 39.0 29.0 40.0 9 35.9355 38.0 35.0 39.0 29.0 40.0 10 35.90275 38.0 35.0 39.0 29.0 40.0 11 36.38625 38.0 35.0 39.0 31.0 40.0 12 35.9915 38.0 35.0 39.0 29.0 40.0 13 36.06025 38.0 35.0 39.0 30.0 40.0 14 35.92 38.0 35.0 39.0 29.0 40.0 15 36.041 38.0 35.0 39.0 30.0 40.0 16 36.1205 38.0 35.0 39.0 30.0 40.0 17 36.2155 38.0 35.0 39.0 30.0 40.0 18 35.8895 38.0 35.0 39.0 29.0 40.0 19 35.92325 38.0 35.0 39.0 29.0 40.0 20 35.9325 38.0 35.0 39.0 29.0 40.0 21 35.44425 38.0 35.0 39.0 28.0 40.0 22 35.68725 38.0 35.0 39.0 29.0 40.0 23 35.7885 38.0 35.0 39.0 29.0 40.0 24 35.82025 38.0 35.0 39.0 30.0 40.0 25 35.55325 38.0 35.0 39.0 29.0 40.0 26 35.545 38.0 35.0 39.0 29.0 40.0 27 35.1165 38.0 34.0 39.0 28.0 40.0 28 34.841 38.0 33.0 39.0 27.0 40.0 29 34.95975 38.0 33.0 39.0 28.0 40.0 30 34.68575 38.0 33.0 39.0 27.0 40.0 31 34.52 38.0 33.0 39.0 27.0 40.0 32 34.289 37.0 33.0 39.0 26.0 40.0 33 34.14225 37.0 33.0 39.0 26.0 40.0 34 34.16925 37.0 33.0 39.0 26.0 40.0 35 33.87525 36.0 33.0 39.0 25.0 40.0 36 33.74075 37.0 33.0 39.0 23.0 40.0 37 33.76025 36.0 32.0 39.0 25.0 40.0 38 33.3475 36.0 31.0 39.0 23.0 40.0 39 33.26925 36.0 31.0 39.0 23.0 40.0 40 33.20975 36.0 32.0 39.0 23.0 40.0 41 33.1075 36.0 32.0 39.0 23.0 40.0 42 33.118 36.0 31.0 39.0 23.0 40.0 43 33.034 36.0 31.0 39.0 23.0 40.0 44 33.05425 36.0 32.0 39.0 23.0 40.0 45 32.81375 36.0 31.0 38.0 23.0 39.0 46 32.967 36.0 32.0 39.0 23.0 40.0 47 32.61525 35.0 31.0 38.0 23.0 39.0 48 32.6155 36.0 31.0 38.0 23.0 39.0 49 32.44675 36.0 31.0 38.0 23.0 39.0 50 32.42725 36.0 31.0 38.0 22.0 39.0 51 31.9375 35.0 31.0 38.0 18.0 39.0 52 31.8445 35.0 31.0 38.0 19.0 39.0 53 31.279 35.0 30.0 38.0 18.0 39.0 54 31.1405 35.0 30.0 38.0 17.0 39.0 55 31.14725 35.0 30.0 38.0 17.0 39.0 56 30.81825 35.0 30.0 38.0 12.0 39.0 57 30.27275 34.0 29.0 37.0 8.0 39.0 58 30.07175 34.0 29.0 37.0 8.0 39.0 59 29.99025 34.0 29.0 37.0 2.0 39.0 60 29.47525 33.0 28.0 36.0 2.0 39.0 61 29.4205 34.0 28.0 37.0 2.0 39.0 62 28.89875 33.0 27.0 36.0 2.0 39.0 63 28.8605 33.0 27.0 36.0 2.0 39.0 64 28.5965 33.0 27.0 36.0 2.0 39.0 65 27.8135 33.0 26.0 36.0 2.0 38.0 66 27.9725 33.0 26.0 36.0 2.0 39.0 67 27.52025 33.0 25.0 36.0 2.0 38.0 68 27.2535 33.0 25.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 3.0 5 1.0 6 0.0 7 6.0 8 8.0 9 8.0 10 9.0 11 14.0 12 12.0 13 13.0 14 23.0 15 16.0 16 14.0 17 26.0 18 15.0 19 15.0 20 23.0 21 30.0 22 34.0 23 48.0 24 42.0 25 51.0 26 64.0 27 77.0 28 89.0 29 119.0 30 113.0 31 157.0 32 193.0 33 223.0 34 288.0 35 394.0 36 506.0 37 595.0 38 564.0 39 193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.7553702299722 15.794794035885772 18.043972706595905 42.40586302754612 2 19.525000000000002 25.025 38.125 17.325 3 20.75 28.575 28.925 21.75 4 22.6 35.825 21.125 20.45 5 24.75 34.775 24.05 16.425 6 19.0 37.375 23.7 19.925 7 16.625 17.474999999999998 43.525000000000006 22.375 8 18.525 22.0 30.325000000000003 29.15 9 21.55 23.05 30.9 24.5 10 18.65 40.175 24.725 16.45 11 24.975 28.549999999999997 20.849999999999998 25.624999999999996 12 20.175 26.025 29.775000000000002 24.025 13 18.425 29.275000000000002 31.724999999999998 20.575 14 19.650000000000002 28.425 29.775000000000002 22.15 15 21.05 28.275 29.125 21.55 16 22.225 27.675 26.35 23.75 17 22.650000000000002 27.1 28.15 22.1 18 22.425 27.625 28.199999999999996 21.75 19 20.375 28.549999999999997 27.900000000000002 23.175 20 22.175 28.199999999999996 27.950000000000003 21.675 21 20.875 29.925 28.375 20.825 22 20.4 28.075 29.049999999999997 22.475 23 21.2 30.075000000000003 27.474999999999998 21.25 24 20.25 29.375 29.225 21.15 25 21.025 27.750000000000004 27.825 23.400000000000002 26 21.6 29.2 27.1 22.1 27 22.55 28.749999999999996 27.025 21.675 28 20.625 29.275000000000002 28.599999999999998 21.5 29 21.575 29.975 27.375 21.075 30 21.65 27.85 29.15 21.349999999999998 31 19.7 29.425 27.900000000000002 22.975 32 20.875 30.75 27.275 21.099999999999998 33 20.7 29.099999999999998 27.800000000000004 22.400000000000002 34 21.675 29.099999999999998 27.925 21.3 35 22.825 28.000000000000004 28.4 20.775 36 19.575 30.575000000000003 29.099999999999998 20.75 37 21.875 27.125 27.875 23.125 38 21.0 28.075 27.650000000000002 23.275000000000002 39 21.725 29.075 27.975 21.224999999999998 40 21.875 28.025 28.349999999999998 21.75 41 21.725 29.525000000000002 28.475 20.275000000000002 42 20.3 29.099999999999998 28.749999999999996 21.85 43 22.400000000000002 29.799999999999997 27.85 19.950000000000003 44 20.849999999999998 29.45 28.225 21.475 45 23.674999999999997 28.325 26.950000000000003 21.05 46 21.8 29.175 28.199999999999996 20.825 47 21.224999999999998 29.5 27.700000000000003 21.575 48 20.424999999999997 27.6 28.999999999999996 22.975 49 21.275 29.175 27.750000000000004 21.8 50 22.675 27.900000000000002 28.375 21.05 51 20.974999999999998 28.549999999999997 28.275 22.2 52 21.125 28.625 27.525 22.725 53 21.2 29.2 28.4 21.2 54 21.224999999999998 28.499999999999996 26.950000000000003 23.325000000000003 55 19.525000000000002 27.3 29.975 23.200000000000003 56 21.925 28.249999999999996 28.425 21.4 57 22.675 27.0 27.1 23.225 58 20.175 27.875 29.049999999999997 22.900000000000002 59 22.35 28.275 28.075 21.3 60 22.1 28.849999999999998 27.05 22.0 61 20.625 28.349999999999998 28.725 22.3 62 21.05 27.675 30.275000000000002 21.0 63 20.825 30.375000000000004 27.450000000000003 21.349999999999998 64 21.55 30.2 28.000000000000004 20.25 65 22.425 28.749999999999996 27.500000000000004 21.325 66 22.475 30.375000000000004 27.224999999999998 19.925 67 21.2 29.525000000000002 28.549999999999997 20.724999999999998 68 21.9 29.5 28.050000000000004 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 2.0 17 2.0 18 2.0 19 2.0 20 1.5 21 3.5 22 6.0 23 8.0 24 13.5 25 17.0 26 19.5 27 27.0 28 32.0 29 35.0 30 55.0 31 72.0 32 79.0 33 109.0 34 132.0 35 143.0 36 192.5 37 231.0 38 243.5 39 266.5 40 299.0 41 321.0 42 322.5 43 340.0 44 356.0 45 343.0 46 310.5 47 291.0 48 279.5 49 232.0 50 196.0 51 195.5 52 161.5 53 128.0 54 113.0 55 77.5 56 57.0 57 47.5 58 31.5 59 25.0 60 17.5 61 7.5 62 5.0 63 3.5 64 3.0 65 3.5 66 3.0 67 2.5 68 1.0 69 0.0 70 1.5 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.38962360122076 97.7 2 0.4832146490335707 0.95 3 0.025432349949135298 0.075 4 0.0 0.0 5 0.025432349949135298 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.050864699898270596 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTA 26 0.65 TruSeq Adapter, Index 4 (100% over 47bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 12 0.3 TruSeq Adapter, Index 4 (100% over 63bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAGATC 8 0.2 TruSeq Adapter, Index 4 (100% over 63bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAA 5 0.125 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10 0.25 0.0 0.0 0.0 0.0 11 0.25 0.0 0.0 0.0 0.0 12 0.25 0.0 0.0 0.0 0.0 13 0.25 0.0 0.0 0.0 0.0 14 0.25 0.0 0.0 0.0 0.0 15 0.25 0.0 0.0 0.0 0.0 16 0.25 0.0 0.0 0.0 0.0 17 0.25 0.0 0.0 0.0 0.0 18 0.25 0.0 0.0 0.0 0.0 19 0.25 0.0 0.0 0.0 0.0 20 0.25 0.0 0.0 0.0 0.0 21 1.1 0.0 0.0 0.0 0.0 22 1.125 0.0 0.0 0.0 0.0 23 1.125 0.0 0.0 0.0 0.0 24 1.125 0.0 0.0 0.0 0.0 25 1.15 0.0 0.0 0.0 0.0 26 1.15 0.0 0.0 0.0 0.0 27 1.15 0.0 0.0 0.0 0.0 28 1.15 0.0 0.0 0.0 0.0 29 1.15 0.0 0.0 0.0 0.0 30 1.15 0.0 0.0 0.0 0.0 31 1.15 0.0 0.0 0.0 0.0 32 1.15 0.0 0.0 0.0 0.0 33 1.15 0.0 0.0 0.0 0.0 34 1.15 0.0 0.0 0.0 0.0 35 1.15 0.0 0.0 0.0 0.0 36 1.15 0.0 0.0 0.0 0.0 37 1.15 0.0 0.0 0.0 0.0 38 1.15 0.0 0.0 0.0 0.0 39 1.15 0.0 0.0 0.0 0.0 40 1.15 0.0 0.0 0.0 0.0 41 1.15 0.0 0.0 0.0 0.0 42 1.15 0.0 0.0 0.0 0.0 43 1.15 0.0 0.0 0.0 0.0 44 1.175 0.0 0.0 0.0 0.0 45 1.175 0.0 0.0 0.0 0.0 46 1.175 0.0 0.0 0.0 0.0 47 1.175 0.0 0.0 0.0 0.0 48 1.175 0.0 0.0 0.0 0.0 49 1.175 0.0 0.0 0.0 0.0 50 1.175 0.0 0.0 0.0 0.0 51 1.175 0.0 0.0 0.0 0.0 52 1.175 0.0 0.0 0.0 0.0 53 1.175 0.0 0.0 0.0 0.0 54 1.175 0.0 0.0 0.0 0.0 55 1.175 0.0 0.0 0.0 0.0 56 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra Read 358616 spots for SRR3207708.sra Written 358616 spots for SRR3207708.sra Read 358599 spots for SRR3207708.sra Written 358599 spots for SRR3207708.sra SRR ids: ['SRR3207708.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8rcfi72t SRR3207708.sra spots: 7171997 blocks: [[1, 358599], [358600, 717198], [717199, 1075797], [1075798, 1434396], [1434397, 1792995], [1792996, 2151594], [2151595, 2510193], [2510194, 2868792], [2868793, 3227391], [3227392, 3585990], [3585991, 3944589], [3944590, 4303188], [4303189, 4661787], [4661788, 5020386], [5020387, 5378985], [5378986, 5737584], [5737585, 6096183], [6096184, 6454782], [6454783, 6813381], [6813382, 7171997]] SRR3207708 file size 1505981 SRR3207708 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207708 SRR3207708_1.fastq Input file: SRR3207708_1.fastq trimmed: SRR3207708-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:43:28 2025 >> started Mon Feb 10 15:43:32 2025 >> done (3.260s) 7171997 reads processed; of these: 20706 ( 0.29%) short reads filtered out after trimming by size control 81328 ( 1.13%) empty reads filtered out after trimming by size control 7069963 (98.58%) reads available; of these: 661884 ( 9.36%) trimmed reads available after processing 6408079 (90.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2258 0.03% 19 4031 0.06% 20 42697 0.60% 21 2394 0.03% 22 2543 0.04% 23 3739 0.05% 24 6104 0.09% 25 10181 0.14% 26 3671 0.05% 27 3663 0.05% 28 4533 0.06% 29 7064 0.10% 30 12042 0.17% 31 2973 0.04% 32 4004 0.06% 33 5128 0.07% 34 7356 0.10% 35 11460 0.16% 36 2853 0.04% 37 3831 0.05% 38 5250 0.07% 39 7891 0.11% 40 11565 0.16% 41 2932 0.04% 42 4167 0.06% 43 5977 0.08% 44 9194 0.13% 45 14315 0.20% 46 3500 0.05% 47 5152 0.07% 48 7785 0.11% 49 13795 0.20% 50 21358 0.30% 51 5311 0.08% 52 8118 0.11% 53 12639 0.18% 54 21085 0.30% 55 37917 0.54% 56 7777 0.11% 57 11379 0.16% 58 17507 0.25% 59 29863 0.42% 60 52747 0.75% 61 10764 0.15% 62 15772 0.22% 63 24531 0.35% 64 42913 0.61% 65 69940 0.99% 66 14782 0.21% 67 23433 0.33% 68 6408079 90.64% 7069963 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=21.86 fanout-score-rank=9 prefix-density=0.72 prefix-fanout=1.1 sequence=CTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=15 fanout-score=183.23 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=20.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:44:02 Started mapping on | Feb 10 15:44:02 Finished on | Feb 10 15:44:11 Mapping speed, Million of reads per hour | 2827.99 Number of input reads | 7069963 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6714084 Uniquely mapped reads % | 94.97% Average mapped length | 66.59 Number of splices: Total | 1229573 Number of splices: Annotated (sjdb) | 1207953 Number of splices: GT/AG | 1210044 Number of splices: GC/AG | 16229 Number of splices: AT/AC | 1537 Number of splices: Non-canonical | 1763 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257093 % of reads mapped to multiple loci | 3.64% Number of reads mapped to too many loci | 56857 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 98786 98786 98786 N_multimapping 257093 257093 257093 N_noFeature 363528 3491203 3544796 N_ambiguous 62990 10653 10813 UnstrandedReadsAssigned:6287566 PositiveStrandReadsAssigned:3212228 NegativeStrandReadsAssigned:3158475 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207708 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207708-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,069,963 reads, 6,427,021 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR3207708.ke.tsv 34699 SRR3207708.se.tsv 87100 total ==> SRR3207708.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 230.497 28.249 Potri.005G024800.1.v4.1 1035 936 65 16.3324 Potri.004G059700.1.v4.1 961 862 8 2.18271 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 139.813 11.562 Potri.016G087400.1.v4.1 270 171 216 297.079 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 25.5757 3.59323 Potri.012G127500.1.v4.1 977 878 1128 302.154 ==> SRR3207708.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1031 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 118 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207708 completed mapping pipeline successfully