Starting /dee2/code/volunteer_pipeline.sh SRR3207709 current disk space = 3059116527616 free memory = 1189150880 SRR3207709 SRAfilesize 58a01479b634867690b988f6b4f56efc SRR3207709.sra SRR3207709.sra file validated SRR3207709 is single end SRR3207709 is conventional basespace SRR3207709 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207709_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.75075 38.0 36.0 39.0 33.0 40.0 2 36.28475 38.0 35.0 39.0 30.0 40.0 3 36.2665 38.0 35.0 39.0 30.0 40.0 4 36.15775 38.0 35.0 39.0 30.0 40.0 5 36.0385 38.0 35.0 39.0 30.0 40.0 6 36.13175 38.0 35.0 39.0 30.0 40.0 7 36.2005 38.0 35.0 39.0 30.0 40.0 8 35.88125 38.0 35.0 39.0 29.0 40.0 9 35.75525 38.0 35.0 39.0 29.0 40.0 10 35.65175 38.0 35.0 39.0 29.0 40.0 11 36.0395 38.0 35.0 39.0 30.0 40.0 12 35.7725 38.0 35.0 39.0 29.0 40.0 13 35.741 38.0 35.0 39.0 29.0 40.0 14 35.517 38.0 34.0 39.0 28.0 40.0 15 35.50175 38.0 34.0 39.0 29.0 40.0 16 35.75925 38.0 35.0 39.0 29.0 40.0 17 35.771 38.0 35.0 39.0 29.0 40.0 18 35.3895 38.0 33.0 39.0 28.0 40.0 19 35.4945 38.0 34.0 39.0 29.0 40.0 20 35.37175 38.0 34.0 39.0 28.0 40.0 21 35.086 38.0 33.0 39.0 27.0 40.0 22 35.2555 38.0 34.0 39.0 28.0 40.0 23 35.201 38.0 33.0 39.0 28.0 40.0 24 35.36975 38.0 34.0 39.0 29.0 40.0 25 35.1015 38.0 33.0 39.0 28.0 40.0 26 34.986 38.0 34.0 39.0 28.0 40.0 27 34.59475 38.0 33.0 39.0 27.0 40.0 28 34.1305 37.0 33.0 39.0 26.0 40.0 29 34.236 38.0 33.0 39.0 26.0 40.0 30 34.049 37.0 33.0 39.0 26.0 40.0 31 33.7635 37.0 33.0 39.0 25.0 40.0 32 33.40525 36.0 32.0 39.0 23.0 40.0 33 33.224 36.0 31.0 39.0 23.0 40.0 34 33.22975 36.0 32.0 39.0 23.0 40.0 35 32.7585 36.0 31.0 39.0 22.0 40.0 36 32.74825 36.0 31.0 39.0 21.0 40.0 37 32.6475 36.0 31.0 39.0 22.0 40.0 38 32.3285 36.0 30.0 39.0 20.0 40.0 39 32.03925 35.0 30.0 38.0 19.0 40.0 40 31.9905 35.0 30.0 38.0 19.0 40.0 41 31.764 35.0 30.0 38.0 17.0 39.0 42 31.84825 35.0 30.0 38.0 18.0 39.0 43 31.727 35.0 30.0 38.0 18.0 39.0 44 31.73775 35.0 30.0 38.0 18.0 39.0 45 31.40325 35.0 30.0 38.0 15.0 39.0 46 31.43725 35.0 30.0 38.0 14.0 39.0 47 31.12425 35.0 29.0 38.0 13.0 39.0 48 30.92025 35.0 29.0 38.0 11.0 39.0 49 30.94725 35.0 30.0 38.0 10.0 39.0 50 30.83625 35.0 29.0 38.0 2.0 39.0 51 30.351 35.0 29.0 38.0 2.0 39.0 52 30.261 35.0 29.0 38.0 2.0 39.0 53 29.4055 33.0 27.0 37.0 2.0 39.0 54 29.4115 34.0 27.0 37.0 2.0 39.0 55 29.3715 34.0 28.0 37.0 2.0 39.0 56 29.068 34.0 27.0 37.0 2.0 39.0 57 28.44175 33.0 26.0 37.0 2.0 39.0 58 28.33325 33.0 26.0 37.0 2.0 39.0 59 27.957 33.0 25.0 37.0 2.0 39.0 60 27.287 33.0 23.0 36.0 2.0 39.0 61 27.39775 33.0 24.0 36.0 2.0 39.0 62 26.8125 33.0 23.0 36.0 2.0 38.0 63 26.84775 33.0 23.0 36.0 2.0 38.0 64 26.59025 33.0 23.0 36.0 2.0 38.0 65 25.9535 32.0 22.0 35.0 2.0 38.0 66 25.97675 33.0 18.0 36.0 2.0 39.0 67 25.55625 32.0 18.0 36.0 2.0 38.0 68 25.31725 32.0 17.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 2.0 5 5.0 6 6.0 7 10.0 8 10.0 9 9.0 10 20.0 11 26.0 12 17.0 13 31.0 14 21.0 15 25.0 16 24.0 17 29.0 18 35.0 19 25.0 20 43.0 21 27.0 22 39.0 23 55.0 24 64.0 25 64.0 26 83.0 27 81.0 28 88.0 29 110.0 30 118.0 31 176.0 32 196.0 33 237.0 34 290.0 35 377.0 36 470.0 37 502.0 38 509.0 39 158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.340737001514384 13.604240282685511 16.25441696113074 44.80060575466936 2 19.825 24.125 35.575 20.474999999999998 3 22.85 27.700000000000003 25.85 23.599999999999998 4 26.224999999999998 34.225 17.875 21.675 5 27.224999999999998 34.9 21.099999999999998 16.775000000000002 6 18.85 36.475 24.95 19.725 7 15.975 16.475 44.45 23.1 8 17.724999999999998 22.15 30.775000000000002 29.349999999999998 9 21.075 21.55 31.525 25.85 10 21.0 37.925 22.55 18.525 11 26.325 27.200000000000003 20.275000000000002 26.200000000000003 12 21.975 23.974999999999998 28.625 25.424999999999997 13 20.3 27.900000000000002 29.7 22.1 14 22.525000000000002 26.35 28.375 22.75 15 21.275 27.125 28.575 23.025000000000002 16 22.35 27.474999999999998 27.625 22.55 17 22.900000000000002 28.299999999999997 26.525 22.275 18 22.1 27.875 26.974999999999998 23.05 19 21.775 28.075 26.8 23.35 20 21.875 28.349999999999998 26.950000000000003 22.825 21 22.225 28.299999999999997 26.900000000000002 22.575 22 22.825 27.375 26.75 23.05 23 21.825 28.050000000000004 26.6 23.525 24 21.475 28.7 27.400000000000002 22.425 25 21.875 28.4 26.6 23.125 26 23.599999999999998 26.6 26.224999999999998 23.575 27 22.225 27.150000000000002 27.975 22.650000000000002 28 22.725 27.675 26.075 23.525 29 22.6 28.025 27.025 22.35 30 21.55 26.950000000000003 28.625 22.875 31 21.575 28.675 26.125 23.625 32 22.6 27.250000000000004 27.3 22.85 33 22.6 27.275 26.200000000000003 23.925 34 22.45 28.7 26.375 22.475 35 22.55 27.525 27.025 22.900000000000002 36 22.400000000000002 27.700000000000003 26.6 23.3 37 22.825 27.35 26.674999999999997 23.150000000000002 38 21.45 26.8 28.499999999999996 23.25 39 23.474999999999998 27.500000000000004 25.75 23.275000000000002 40 24.325 27.750000000000004 26.0 21.925 41 22.85 28.175 26.200000000000003 22.775000000000002 42 21.525 28.075 27.750000000000004 22.650000000000002 43 21.975 27.875 27.975 22.175 44 22.825 27.85 27.150000000000002 22.175 45 23.175 27.224999999999998 27.625 21.975 46 22.575 27.0 27.250000000000004 23.175 47 23.775 26.924999999999997 26.55 22.75 48 22.35 27.85 26.400000000000002 23.400000000000002 49 22.15 27.775 27.224999999999998 22.85 50 23.200000000000003 27.675 26.400000000000002 22.725 51 22.05 27.175 27.35 23.425 52 23.125 27.525 25.974999999999998 23.375 53 22.85 28.799999999999997 25.4 22.95 54 22.425 27.474999999999998 27.125 22.975 55 21.725 27.650000000000002 27.125 23.5 56 22.575 29.025000000000002 26.5 21.9 57 22.175 27.175 27.650000000000002 23.0 58 21.925 27.325 27.425 23.325000000000003 59 22.6 27.400000000000002 28.050000000000004 21.95 60 21.675 27.675 27.575 23.075000000000003 61 23.7 26.75 27.275 22.275 62 22.525000000000002 26.75 27.474999999999998 23.25 63 23.474999999999998 26.900000000000002 27.400000000000002 22.225 64 23.225 27.500000000000004 26.224999999999998 23.05 65 22.75 27.400000000000002 28.375 21.475 66 23.799999999999997 26.075 27.025 23.1 67 22.575 28.025 26.400000000000002 23.0 68 22.875 27.500000000000004 26.6 23.025000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 4.5 22 7.0 23 6.5 24 10.5 25 15.0 26 16.5 27 22.5 28 27.0 29 29.5 30 40.5 31 49.0 32 63.5 33 80.0 34 82.0 35 99.5 36 136.5 37 156.0 38 176.0 39 207.0 40 252.0 41 286.0 42 302.5 43 327.0 44 335.0 45 329.5 46 315.0 47 306.0 48 294.5 49 258.0 50 233.0 51 212.0 52 165.5 53 140.0 54 128.5 55 105.5 56 94.0 57 81.0 58 69.0 59 70.0 60 60.5 61 44.5 62 38.0 63 36.0 64 29.0 65 23.0 66 22.0 67 16.0 68 10.5 69 11.0 70 9.0 71 7.0 72 7.0 73 6.0 74 6.5 75 8.0 76 4.5 77 1.5 78 2.0 79 2.5 80 2.0 81 1.0 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.66145018257694 92.65 2 2.660406885758998 5.1 3 0.4173187271778821 1.2 4 0.2347417840375587 0.8999999999999999 5 0.0 0.0 6 0.02608242044861763 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333554 spots for SRR3207709.sra Written 333554 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra Read 333552 spots for SRR3207709.sra Written 333552 spots for SRR3207709.sra SRR ids: ['SRR3207709.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q16p19h9 SRR3207709.sra spots: 6671042 blocks: [[1, 333552], [333553, 667104], [667105, 1000656], [1000657, 1334208], [1334209, 1667760], [1667761, 2001312], [2001313, 2334864], [2334865, 2668416], [2668417, 3001968], [3001969, 3335520], [3335521, 3669072], [3669073, 4002624], [4002625, 4336176], [4336177, 4669728], [4669729, 5003280], [5003281, 5336832], [5336833, 5670384], [5670385, 6003936], [6003937, 6337488], [6337489, 6671042]] SRR3207709 file size 1400702 SRR3207709 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207709 SRR3207709_1.fastq Input file: SRR3207709_1.fastq trimmed: SRR3207709-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:16:21 2025 >> started Mon Feb 10 15:16:25 2025 >> done (4.208s) 6671042 reads processed; of these: 20754 ( 0.31%) short reads filtered out after trimming by size control 16618 ( 0.25%) empty reads filtered out after trimming by size control 6633670 (99.44%) reads available; of these: 777991 (11.73%) trimmed reads available after processing 5855679 (88.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2512 0.04% 19 3927 0.06% 20 6157 0.09% 21 1986 0.03% 22 3015 0.05% 23 4576 0.07% 24 8157 0.12% 25 13309 0.20% 26 3387 0.05% 27 4502 0.07% 28 5929 0.09% 29 9501 0.14% 30 16358 0.25% 31 3769 0.06% 32 5041 0.08% 33 6858 0.10% 34 10619 0.16% 35 15954 0.24% 36 3759 0.06% 37 5519 0.08% 38 7493 0.11% 39 11157 0.17% 40 17295 0.26% 41 4051 0.06% 42 6042 0.09% 43 8208 0.12% 44 13328 0.20% 45 20124 0.30% 46 4498 0.07% 47 6696 0.10% 48 10697 0.16% 49 17990 0.27% 50 28592 0.43% 51 7311 0.11% 52 11099 0.17% 53 16108 0.24% 54 26696 0.40% 55 45812 0.69% 56 9642 0.15% 57 14234 0.21% 58 21784 0.33% 59 36421 0.55% 60 63888 0.96% 61 13086 0.20% 62 18898 0.28% 63 29006 0.44% 64 49145 0.74% 65 79790 1.20% 66 17031 0.26% 67 27034 0.41% 68 5855679 88.27% 6633670 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=16 fanout-score=101.13 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=15.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 15:16:39 Started mapping on | Feb 10 15:16:39 Finished on | Feb 10 15:16:50 Mapping speed, Million of reads per hour | 2171.02 Number of input reads | 6633670 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4528587 Uniquely mapped reads % | 68.27% Average mapped length | 66.58 Number of splices: Total | 815651 Number of splices: Annotated (sjdb) | 800927 Number of splices: GT/AG | 802664 Number of splices: GC/AG | 10645 Number of splices: AT/AC | 975 Number of splices: Non-canonical | 1367 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182687 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 1888922 % of reads mapped to too many loci | 28.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1922396 1922396 1922396 N_multimapping 182687 182687 182687 N_noFeature 275588 2360896 2414091 N_ambiguous 43919 7518 7259 UnstrandedReadsAssigned:4209080 PositiveStrandReadsAssigned:2160173 NegativeStrandReadsAssigned:2107237 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207709 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207709-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,633,670 reads, 5,909,228 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR3207709.ke.tsv 34699 SRR3207709.se.tsv 87100 total ==> SRR3207709.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 152 17.7348 Potri.005G024800.1.v4.1 1035 936 46 11.0037 Potri.004G059700.1.v4.1 961 862 10 2.59747 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.2478 4.74318 Potri.016G087400.1.v4.1 270 171 133 174.146 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 2.67505 Potri.012G127500.1.v4.1 977 878 763 194.575 ==> SRR3207709.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 630 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207709 completed mapping pipeline successfully