Starting /dee2/code/volunteer_pipeline.sh SRR3207710 current disk space = 3058905387008 free memory = 1544161476 SRR3207710 SRAfilesize 291f56ff1f001448743a75752fd7e79f SRR3207710.sra SRR3207710.sra file validated SRR3207710 is single end SRR3207710 is conventional basespace SRR3207710 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.89725 39.0 36.0 40.0 33.0 40.0 2 36.6185 38.0 36.0 40.0 31.0 40.0 3 36.53275 38.0 36.0 40.0 31.0 40.0 4 36.45375 38.0 35.0 40.0 31.0 40.0 5 36.499 38.0 36.0 40.0 31.0 40.0 6 36.68625 38.0 36.0 40.0 31.0 40.0 7 36.52925 39.0 36.0 40.0 30.0 40.0 8 36.542 38.0 35.0 40.0 31.0 40.0 9 36.39 38.0 35.0 40.0 30.0 40.0 10 36.42825 38.0 35.0 39.0 30.0 40.0 11 36.67 38.0 36.0 40.0 31.0 40.0 12 36.5695 38.0 35.0 40.0 31.0 40.0 13 36.453 38.0 35.0 39.0 31.0 40.0 14 36.2975 38.0 35.0 39.0 31.0 40.0 15 36.266 38.0 35.0 39.0 31.0 40.0 16 36.3725 38.0 35.0 40.0 31.0 40.0 17 36.12275 38.0 35.0 39.0 30.0 40.0 18 36.12625 38.0 35.0 39.0 30.0 40.0 19 35.9595 38.0 35.0 39.0 29.0 40.0 20 35.97775 38.0 35.0 39.0 29.0 40.0 21 35.924 38.0 35.0 39.0 29.0 40.0 22 36.1155 38.0 35.0 39.0 30.0 40.0 23 35.85075 38.0 35.0 39.0 29.0 40.0 24 36.03675 38.0 35.0 39.0 30.0 40.0 25 35.907 38.0 35.0 39.0 30.0 40.0 26 35.823 38.0 35.0 39.0 30.0 40.0 27 35.48925 38.0 35.0 39.0 28.0 40.0 28 35.52225 38.0 35.0 39.0 29.0 40.0 29 35.39175 38.0 35.0 39.0 29.0 40.0 30 35.139 38.0 34.0 39.0 27.0 40.0 31 35.093 38.0 34.0 39.0 27.0 40.0 32 34.56 38.0 33.0 39.0 26.0 40.0 33 34.64975 38.0 33.0 39.0 27.0 40.0 34 34.2325 37.0 33.0 39.0 25.0 40.0 35 34.53 38.0 33.0 39.0 27.0 40.0 36 34.446 38.0 33.0 39.0 26.0 40.0 37 34.06425 37.0 33.0 39.0 25.0 40.0 38 34.32175 38.0 33.0 39.0 27.0 40.0 39 34.0745 38.0 33.0 39.0 25.0 40.0 40 33.76075 37.0 32.0 39.0 24.0 40.0 41 34.03325 37.0 33.0 39.0 25.0 40.0 42 33.866 37.0 33.0 39.0 25.0 40.0 43 34.02275 38.0 33.0 39.0 25.0 40.0 44 33.57875 36.0 32.0 39.0 23.0 40.0 45 33.82975 37.0 33.0 39.0 25.0 40.0 46 33.841 37.0 33.0 39.0 25.0 40.0 47 33.51475 37.0 33.0 39.0 24.0 40.0 48 33.46375 36.0 33.0 39.0 23.0 40.0 49 33.15675 36.0 32.0 39.0 23.0 40.0 50 33.25175 36.0 32.0 39.0 23.0 40.0 51 33.22725 36.0 33.0 39.0 23.0 40.0 52 33.18675 36.0 32.0 39.0 23.0 40.0 53 32.72775 36.0 31.0 39.0 23.0 40.0 54 32.40725 36.0 31.0 39.0 21.0 40.0 55 32.2305 35.0 31.0 38.0 20.0 40.0 56 32.13375 36.0 31.0 38.0 18.0 40.0 57 31.58075 35.0 30.0 38.0 17.0 39.0 58 31.49125 35.0 30.0 38.0 17.0 39.0 59 30.95175 35.0 30.0 38.0 11.0 39.0 60 30.95875 35.0 30.0 38.0 8.0 39.0 61 30.4215 35.0 29.0 38.0 2.0 39.0 62 30.1155 35.0 29.0 38.0 2.0 39.0 63 29.84925 35.0 28.0 38.0 2.0 39.0 64 29.7605 34.0 28.0 38.0 2.0 39.0 65 29.56175 34.0 28.0 38.0 2.0 39.0 66 29.468 34.0 29.0 38.0 2.0 39.0 67 29.29275 34.0 29.0 38.0 2.0 39.0 68 29.01125 34.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 0.0 5 1.0 6 4.0 7 5.0 8 8.0 9 10.0 10 8.0 11 6.0 12 16.0 13 16.0 14 9.0 15 9.0 16 20.0 17 9.0 18 19.0 19 11.0 20 30.0 21 24.0 22 30.0 23 31.0 24 36.0 25 43.0 26 58.0 27 83.0 28 92.0 29 79.0 30 102.0 31 110.0 32 141.0 33 217.0 34 258.0 35 356.0 36 458.0 37 575.0 38 682.0 39 426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.9158001521684 15.191478569617042 15.926959168146082 44.965762110068475 2 19.25 26.900000000000002 37.25 16.6 3 20.849999999999998 30.25 27.474999999999998 21.425 4 23.175 35.6 20.549999999999997 20.674999999999997 5 24.825 37.125 21.875 16.175 6 17.45 38.05 24.65 19.85 7 15.475 16.5 47.025 21.0 8 19.475 23.35 30.8 26.375 9 20.575 22.05 31.75 25.624999999999996 10 19.900000000000002 39.825 23.1 17.175 11 25.324999999999996 28.15 21.875 24.65 12 21.05 23.575 29.975 25.4 13 20.075000000000003 28.825 31.15 19.950000000000003 14 19.325 28.000000000000004 31.35 21.325 15 21.275 27.200000000000003 28.599999999999998 22.925 16 20.05 28.275 30.25 21.425 17 22.400000000000002 28.975 25.95 22.675 18 21.45 28.299999999999997 27.875 22.375 19 21.2 28.95 27.825 22.025 20 22.6 28.549999999999997 27.975 20.875 21 21.224999999999998 28.65 28.025 22.1 22 20.8 29.75 27.525 21.925 23 21.125 30.525000000000002 28.349999999999998 20.0 24 21.825 28.325 29.375 20.474999999999998 25 20.974999999999998 28.875 26.875 23.275000000000002 26 21.655413853463365 29.35733933483371 27.956989247311824 21.030257564391096 27 22.025 27.975 27.6 22.400000000000002 28 21.875 28.575 28.050000000000004 21.5 29 21.3 28.95 28.075 21.675 30 21.95 29.225 27.200000000000003 21.625 31 22.175 28.9 26.825 22.1 32 21.25 29.45 27.6 21.7 33 21.075 29.9 27.125 21.9 34 20.8 28.925 27.675 22.6 35 22.475 29.7 27.800000000000004 20.025000000000002 36 21.275 29.675 27.425 21.625 37 21.675 28.000000000000004 29.525000000000002 20.8 38 22.675 29.95 26.3 21.075 39 20.95 30.45 26.224999999999998 22.375 40 21.43035758939735 29.182295573893473 27.581895473868467 21.80545136284071 41 21.625 29.65 27.85 20.875 42 21.7 27.425 28.749999999999996 22.125 43 20.9 29.075 28.349999999999998 21.675 44 22.325 29.125 28.15 20.4 45 20.575 30.049999999999997 28.4 20.974999999999998 46 21.05 29.15 26.474999999999998 23.325000000000003 47 21.725 29.875 27.175 21.224999999999998 48 21.230307576894223 29.107276819204802 27.93198299574894 21.73043260815204 49 21.224999999999998 28.199999999999996 28.499999999999996 22.075 50 21.8 28.975 28.275 20.95 51 21.025 27.675 29.599999999999998 21.7 52 21.85 27.85 28.599999999999998 21.7 53 21.349999999999998 29.525000000000002 27.450000000000003 21.675 54 20.974999999999998 28.599999999999998 28.799999999999997 21.625 55 20.3 29.15 28.050000000000004 22.5 56 21.224999999999998 30.025000000000002 28.1 20.65 57 21.3 28.999999999999996 27.325 22.375 58 21.475 30.275000000000002 27.650000000000002 20.599999999999998 59 22.175 29.5 27.125 21.2 60 21.05 28.825 27.85 22.275 61 21.425 29.15 28.7 20.724999999999998 62 22.075 29.525000000000002 27.275 21.125 63 21.575 29.25 27.700000000000003 21.475 64 21.15 28.375 28.9 21.575 65 21.55 30.2 27.275 20.974999999999998 66 21.75 28.575 28.349999999999998 21.325 67 21.675 29.125 27.875 21.325 68 21.95 30.65 27.325 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 2.0 17 1.5 18 2.5 19 4.0 20 4.5 21 6.0 22 7.0 23 8.5 24 12.0 25 14.0 26 15.0 27 26.0 28 36.0 29 46.0 30 61.0 31 66.0 32 80.0 33 113.5 34 133.0 35 153.5 36 195.5 37 217.0 38 229.0 39 261.0 40 313.5 41 346.0 42 344.0 43 327.5 44 313.0 45 318.0 46 317.0 47 311.0 48 289.0 49 239.0 50 211.0 51 179.0 52 138.0 53 129.0 54 108.0 55 68.5 56 50.0 57 45.5 58 31.0 59 21.0 60 19.0 61 11.0 62 5.0 63 4.0 64 4.5 65 4.0 66 2.0 67 2.5 68 3.0 69 3.0 70 2.5 71 2.0 72 2.0 73 4.5 74 3.5 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.025 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330016 spots for SRR3207710.sra Written 330016 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra Read 330000 spots for SRR3207710.sra Written 330000 spots for SRR3207710.sra SRR ids: ['SRR3207710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ld3s9id6 SRR3207710.sra spots: 6600016 blocks: [[1, 330000], [330001, 660000], [660001, 990000], [990001, 1320000], [1320001, 1650000], [1650001, 1980000], [1980001, 2310000], [2310001, 2640000], [2640001, 2970000], [2970001, 3300000], [3300001, 3630000], [3630001, 3960000], [3960001, 4290000], [4290001, 4620000], [4620001, 4950000], [4950001, 5280000], [5280001, 5610000], [5610001, 5940000], [5940001, 6270000], [6270001, 6600016]] SRR3207710 file size 1385818 SRR3207710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207710 SRR3207710_1.fastq Input file: SRR3207710_1.fastq trimmed: SRR3207710-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:39:03 2025 >> started Mon Feb 10 15:39:06 2025 >> done (3.183s) 6600016 reads processed; of these: 15519 ( 0.24%) short reads filtered out after trimming by size control 11629 ( 0.18%) empty reads filtered out after trimming by size control 6572868 (99.59%) reads available; of these: 529212 ( 8.05%) trimmed reads available after processing 6043656 (91.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1612 0.02% 19 2385 0.04% 20 3615 0.05% 21 1169 0.02% 22 1796 0.03% 23 2970 0.05% 24 4824 0.07% 25 7700 0.12% 26 2105 0.03% 27 2715 0.04% 28 3731 0.06% 29 6069 0.09% 30 9476 0.14% 31 2419 0.04% 32 2938 0.04% 33 4270 0.06% 34 5957 0.09% 35 8738 0.13% 36 2303 0.04% 37 2966 0.05% 38 4119 0.06% 39 6149 0.09% 40 9414 0.14% 41 2291 0.03% 42 3308 0.05% 43 5021 0.08% 44 7867 0.12% 45 12043 0.18% 46 3194 0.05% 47 4464 0.07% 48 6793 0.10% 49 11676 0.18% 50 18346 0.28% 51 4837 0.07% 52 7146 0.11% 53 10806 0.16% 54 17600 0.27% 55 32137 0.49% 56 6939 0.11% 57 9979 0.15% 58 15240 0.23% 59 25795 0.39% 60 47570 0.72% 61 9564 0.15% 62 13386 0.20% 63 21038 0.32% 64 37374 0.57% 65 61198 0.93% 66 12942 0.20% 67 21218 0.32% 68 6043656 91.95% 6572868 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=125.38 fanout-score-rank=7 prefix-density=0.25 prefix-fanout=17.6 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=16 fanout-score=250.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=23.5 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:39:21 Started mapping on | Feb 10 15:39:22 Finished on | Feb 10 15:39:27 Mapping speed, Million of reads per hour | 4732.46 Number of input reads | 6572868 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6216765 Uniquely mapped reads % | 94.58% Average mapped length | 66.72 Number of splices: Total | 1113031 Number of splices: Annotated (sjdb) | 1092615 Number of splices: GT/AG | 1095141 Number of splices: GC/AG | 14666 Number of splices: AT/AC | 1456 Number of splices: Non-canonical | 1768 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222046 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 101441 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 134057 134057 134057 N_multimapping 222046 222046 222046 N_noFeature 332037 3235194 3274599 N_ambiguous 58880 9960 10004 UnstrandedReadsAssigned:5825848 PositiveStrandReadsAssigned:2971611 NegativeStrandReadsAssigned:2932162 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207710 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207710-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,572,868 reads, 6,024,827 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR3207710.ke.tsv 34699 SRR3207710.se.tsv 87100 total ==> SRR3207710.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 183 22.6986 Potri.005G024800.1.v4.1 1035 936 56 14.2408 Potri.004G059700.1.v4.1 961 862 24 6.62714 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 115.969 9.70589 Potri.016G087400.1.v4.1 270 171 244 339.638 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 28 3.9813 Potri.012G127500.1.v4.1 977 878 1676 454.362 ==> SRR3207710.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 868 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 106 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207710 completed mapping pipeline successfully