Starting /dee2/code/volunteer_pipeline.sh SRR3207711 current disk space = 3059096121344 free memory = 1272643160 SRR3207711 SRAfilesize 6e47718f0e0b1abcf511cac43dd34161 SRR3207711.sra SRR3207711.sra file validated SRR3207711 is single end SRR3207711 is conventional basespace SRR3207711 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7045 38.0 36.0 40.0 33.0 40.0 2 36.432 38.0 35.0 39.0 31.0 40.0 3 36.343 38.0 36.0 39.0 30.0 40.0 4 36.26 38.0 35.0 39.0 30.0 40.0 5 36.252 38.0 35.0 39.0 30.0 40.0 6 36.5095 38.0 36.0 39.0 31.0 40.0 7 36.42725 38.0 35.0 40.0 31.0 40.0 8 36.44375 38.0 35.0 40.0 31.0 40.0 9 36.3125 38.0 35.0 40.0 30.0 40.0 10 36.33375 38.0 35.0 39.0 30.0 40.0 11 36.628 38.0 36.0 39.0 31.0 40.0 12 36.443 38.0 35.0 39.0 31.0 40.0 13 36.1445 38.0 35.0 39.0 30.0 40.0 14 36.29375 38.0 35.0 39.0 31.0 40.0 15 36.06525 38.0 35.0 39.0 30.0 40.0 16 36.2335 38.0 35.0 39.0 30.0 40.0 17 35.9945 38.0 35.0 39.0 30.0 40.0 18 35.996 38.0 35.0 39.0 30.0 40.0 19 35.90775 38.0 35.0 39.0 29.0 40.0 20 35.90275 38.0 35.0 39.0 29.0 40.0 21 35.85925 38.0 35.0 39.0 29.0 40.0 22 36.01275 38.0 35.0 39.0 30.0 40.0 23 35.76525 38.0 35.0 39.0 29.0 40.0 24 35.83875 38.0 35.0 39.0 29.0 40.0 25 35.6385 38.0 35.0 39.0 29.0 40.0 26 35.68625 38.0 35.0 39.0 29.0 40.0 27 35.33225 38.0 34.0 39.0 29.0 40.0 28 35.39 38.0 35.0 39.0 29.0 40.0 29 35.08125 38.0 33.0 39.0 28.0 40.0 30 35.01 38.0 33.0 39.0 27.0 40.0 31 34.96475 38.0 34.0 39.0 27.0 40.0 32 34.49875 38.0 33.0 39.0 27.0 40.0 33 34.66875 38.0 33.0 39.0 27.0 40.0 34 34.2045 38.0 33.0 39.0 25.0 40.0 35 34.47075 38.0 33.0 39.0 26.0 40.0 36 34.36975 38.0 33.0 39.0 26.0 40.0 37 34.01275 37.0 33.0 39.0 25.0 40.0 38 34.18025 38.0 33.0 39.0 26.0 40.0 39 34.162 37.0 33.0 39.0 25.0 40.0 40 33.76125 37.0 32.0 39.0 25.0 40.0 41 33.91425 37.0 33.0 39.0 25.0 40.0 42 33.87925 37.0 33.0 39.0 25.0 40.0 43 33.941 37.0 33.0 39.0 25.0 40.0 44 33.475 36.0 32.0 39.0 23.0 40.0 45 33.741 37.0 33.0 39.0 25.0 40.0 46 33.5885 37.0 33.0 39.0 23.0 40.0 47 33.39425 36.0 32.0 39.0 23.0 40.0 48 33.2325 36.0 32.0 39.0 23.0 40.0 49 33.04025 36.0 32.0 39.0 23.0 40.0 50 33.062 36.0 32.0 39.0 23.0 40.0 51 33.079 36.0 32.0 39.0 23.0 40.0 52 32.89725 36.0 31.0 39.0 23.0 40.0 53 32.63725 36.0 31.0 39.0 22.0 40.0 54 32.2925 36.0 31.0 38.0 20.0 39.0 55 32.11625 35.0 31.0 38.0 21.0 40.0 56 32.0015 36.0 31.0 38.0 17.0 40.0 57 31.415 35.0 30.0 38.0 16.0 39.0 58 31.4005 35.0 30.0 38.0 17.0 39.0 59 30.89925 35.0 29.0 38.0 11.0 39.0 60 31.04275 35.0 30.0 38.0 10.0 39.0 61 30.3495 35.0 29.0 38.0 2.0 39.0 62 30.07 35.0 29.0 38.0 2.0 39.0 63 29.66625 34.0 28.0 38.0 2.0 39.0 64 29.36075 34.0 27.0 38.0 2.0 39.0 65 29.44525 34.0 29.0 38.0 2.0 39.0 66 28.89825 34.0 27.0 38.0 2.0 39.0 67 28.7005 34.0 27.0 37.0 2.0 39.0 68 28.627 34.0 27.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 1.0 5 1.0 6 3.0 7 7.0 8 5.0 9 6.0 10 4.0 11 11.0 12 14.0 13 7.0 14 11.0 15 12.0 16 13.0 17 20.0 18 14.0 19 19.0 20 27.0 21 24.0 22 34.0 23 37.0 24 42.0 25 47.0 26 55.0 27 77.0 28 88.0 29 95.0 30 113.0 31 138.0 32 150.0 33 202.0 34 266.0 35 349.0 36 470.0 37 547.0 38 658.0 39 409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.96276460086713 16.475388931395052 16.27135934710533 41.29048712063249 2 17.95 27.775 38.224999999999994 16.05 3 21.0 28.799999999999997 27.725 22.475 4 23.974999999999998 34.25 21.224999999999998 20.549999999999997 5 24.15 35.575 23.575 16.7 6 17.25 40.0 23.825 18.925 7 15.7 17.65 44.975 21.675 8 19.375 22.275 30.85 27.500000000000004 9 21.45 23.125 30.2 25.224999999999998 10 19.625 40.725 23.425 16.225 11 25.05 27.85 21.5 25.6 12 20.674999999999997 24.85 28.625 25.85 13 18.325 29.375 31.5 20.8 14 19.575 28.625 30.099999999999998 21.7 15 21.15 28.15 28.499999999999996 22.2 16 21.275 27.250000000000004 28.799999999999997 22.675 17 21.825 29.25 27.175 21.75 18 22.075 27.35 28.275 22.3 19 22.15 28.249999999999996 27.025 22.575 20 22.225 28.050000000000004 28.475 21.25 21 21.525 28.475 27.400000000000002 22.6 22 19.5 29.5 27.075 23.925 23 21.5 29.575000000000003 27.85 21.075 24 21.275 28.9 26.700000000000003 23.125 25 21.725 29.275000000000002 27.05 21.95 26 22.28614307153577 29.239619809904955 26.28814407203602 22.18609304652326 27 20.05 28.525 28.425 23.0 28 20.150000000000002 29.299999999999997 28.599999999999998 21.95 29 22.05 28.449999999999996 27.750000000000004 21.75 30 21.05 29.125 28.425 21.4 31 22.425 27.975 28.199999999999996 21.4 32 20.8 29.049999999999997 27.950000000000003 22.2 33 20.925 28.375 27.675 23.025000000000002 34 20.925 29.799999999999997 26.650000000000002 22.625 35 22.25 29.099999999999998 28.075 20.575 36 21.375 29.525000000000002 27.675 21.425 37 21.125 28.775000000000002 28.1 22.0 38 20.325 28.775000000000002 28.7 22.2 39 21.4 29.65 26.724999999999998 22.225 40 21.75 28.9 28.050000000000004 21.3 41 21.2 28.599999999999998 30.25 19.950000000000003 42 20.974999999999998 27.925 27.6 23.5 43 21.725 28.775000000000002 28.249999999999996 21.25 44 20.65 29.549999999999997 27.525 22.275 45 21.5 28.725 27.725 22.05 46 22.6 28.425 27.650000000000002 21.325 47 21.825 30.349999999999998 27.700000000000003 20.125 48 21.875 28.599999999999998 26.125 23.400000000000002 49 20.95 29.475 27.625 21.95 50 21.175 29.799999999999997 27.875 21.15 51 22.325 27.800000000000004 27.325 22.55 52 21.975 26.700000000000003 28.749999999999996 22.575 53 22.5 28.675 27.375 21.45 54 20.45 28.925 28.125 22.5 55 20.9 29.375 28.225 21.5 56 21.3 27.55 29.375 21.775 57 21.125 28.625 27.900000000000002 22.35 58 20.724999999999998 28.65 27.900000000000002 22.725 59 21.55 29.549999999999997 28.025 20.875 60 21.55 28.849999999999998 26.775 22.825 61 21.2 28.975 28.9 20.925 62 21.0 30.049999999999997 28.525 20.424999999999997 63 22.575 28.299999999999997 27.825 21.3 64 22.25 28.175 27.650000000000002 21.925 65 21.875 28.975 27.200000000000003 21.95 66 21.05 28.999999999999996 27.200000000000003 22.75 67 21.65 28.95 28.199999999999996 21.2 68 21.525 30.45 26.724999999999998 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 2.5 16 2.0 17 1.5 18 1.5 19 2.0 20 2.0 21 2.5 22 3.0 23 8.5 24 12.0 25 10.0 26 14.5 27 22.0 28 25.0 29 35.0 30 46.0 31 47.0 32 74.5 33 112.5 34 123.0 35 144.5 36 181.0 37 196.0 38 232.0 39 294.0 40 314.0 41 308.0 42 319.5 43 338.5 44 346.0 45 334.0 46 310.0 47 298.0 48 279.0 49 240.5 50 221.0 51 194.5 52 147.0 53 126.0 54 116.0 55 78.0 56 50.0 57 44.0 58 32.5 59 27.0 60 22.0 61 14.5 62 12.0 63 9.0 64 5.0 65 3.0 66 2.0 67 2.5 68 3.0 69 3.0 70 3.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.05 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52092788703983 98.675 2 0.37821482602118006 0.75 3 0.0 0.0 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.05042864346949068 0.3 7 0.02521432173474534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTA 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 47bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAC 6 0.15 TruSeq Adapter, Index 4 (100% over 63bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 6 0.15 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.3 0.0 0.0 0.0 0.0 22 0.325 0.0 0.0 0.0 0.0 23 0.325 0.0 0.0 0.0 0.0 24 0.325 0.0 0.0 0.0 0.0 25 0.325 0.0 0.0 0.0 0.0 26 0.325 0.0 0.0 0.0 0.0 27 0.325 0.0 0.0 0.0 0.0 28 0.325 0.0 0.0 0.0 0.0 29 0.325 0.0 0.0 0.0 0.0 30 0.325 0.0 0.0 0.0 0.0 31 0.325 0.0 0.0 0.0 0.0 32 0.325 0.0 0.0 0.0 0.0 33 0.325 0.0 0.0 0.0 0.0 34 0.325 0.0 0.0 0.0 0.0 35 0.325 0.0 0.0 0.0 0.0 36 0.325 0.0 0.0 0.0 0.0 37 0.325 0.0 0.0 0.0 0.0 38 0.325 0.0 0.0 0.0 0.0 39 0.325 0.0 0.0 0.0 0.0 40 0.325 0.0 0.0 0.0 0.0 41 0.325 0.0 0.0 0.0 0.0 42 0.325 0.0 0.0 0.0 0.0 43 0.325 0.0 0.0 0.0 0.0 44 0.325 0.0 0.0 0.0 0.0 45 0.325 0.0 0.0 0.0 0.0 46 0.35 0.0 0.0 0.0 0.0 47 0.35 0.0 0.0 0.0 0.0 48 0.375 0.0 0.0 0.0 0.0 49 0.375 0.0 0.0 0.0 0.0 50 0.375 0.0 0.0 0.0 0.0 51 0.4 0.0 0.0 0.0 0.0 52 0.4 0.0 0.0 0.0 0.0 53 0.4 0.0 0.0 0.0 0.0 54 0.4 0.0 0.0 0.0 0.0 55 0.4 0.0 0.0 0.0 0.0 56 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406401 spots for SRR3207711.sra Written 406401 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra Read 406392 spots for SRR3207711.sra Written 406392 spots for SRR3207711.sra SRR ids: ['SRR3207711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dse18woz SRR3207711.sra spots: 8127849 blocks: [[1, 406392], [406393, 812784], [812785, 1219176], [1219177, 1625568], [1625569, 2031960], [2031961, 2438352], [2438353, 2844744], [2844745, 3251136], [3251137, 3657528], [3657529, 4063920], [4063921, 4470312], [4470313, 4876704], [4876705, 5283096], [5283097, 5689488], [5689489, 6095880], [6095881, 6502272], [6502273, 6908664], [6908665, 7315056], [7315057, 7721448], [7721449, 8127849]] SRR3207711 file size 1706878 SRR3207711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207711 SRR3207711_1.fastq Input file: SRR3207711_1.fastq trimmed: SRR3207711-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:28:35 2025 >> started Mon Feb 10 15:28:39 2025 >> done (3.913s) 8127849 reads processed; of these: 21169 ( 0.26%) short reads filtered out after trimming by size control 67480 ( 0.83%) empty reads filtered out after trimming by size control 8039200 (98.91%) reads available; of these: 675221 ( 8.40%) trimmed reads available after processing 7363979 (91.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2148 0.03% 19 3560 0.04% 20 32434 0.40% 21 2145 0.03% 22 2320 0.03% 23 3627 0.05% 24 6076 0.08% 25 9469 0.12% 26 3463 0.04% 27 3731 0.05% 28 4712 0.06% 29 7454 0.09% 30 11561 0.14% 31 3010 0.04% 32 3696 0.05% 33 5265 0.07% 34 7508 0.09% 35 11072 0.14% 36 2984 0.04% 37 3724 0.05% 38 5099 0.06% 39 7713 0.10% 40 11508 0.14% 41 2907 0.04% 42 4188 0.05% 43 6315 0.08% 44 9757 0.12% 45 14911 0.19% 46 3827 0.05% 47 5409 0.07% 48 8134 0.10% 49 14125 0.18% 50 22316 0.28% 51 5799 0.07% 52 8563 0.11% 53 13198 0.16% 54 21256 0.26% 55 39428 0.49% 56 8537 0.11% 57 12158 0.15% 58 18264 0.23% 59 31265 0.39% 60 57279 0.71% 61 11650 0.14% 62 16306 0.20% 63 25355 0.32% 64 45242 0.56% 65 73435 0.91% 66 15681 0.20% 67 25637 0.32% 68 7363979 91.60% 8039200 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=17.38 fanout-score-rank=11 prefix-density=0.48 prefix-fanout=1.2 sequence=CTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=205.61 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.4 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:28:54 Started mapping on | Feb 10 15:28:54 Finished on | Feb 10 15:29:02 Mapping speed, Million of reads per hour | 3617.64 Number of input reads | 8039200 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 7563613 Uniquely mapped reads % | 94.08% Average mapped length | 66.71 Number of splices: Total | 1375243 Number of splices: Annotated (sjdb) | 1350196 Number of splices: GT/AG | 1353292 Number of splices: GC/AG | 17839 Number of splices: AT/AC | 1851 Number of splices: Non-canonical | 2261 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295137 % of reads mapped to multiple loci | 3.67% Number of reads mapped to too many loci | 131085 % of reads mapped to too many loci | 1.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 180450 180450 180450 N_multimapping 295137 295137 295137 N_noFeature 396490 3933270 3981593 N_ambiguous 69222 12105 11961 UnstrandedReadsAssigned:7097901 PositiveStrandReadsAssigned:3618238 NegativeStrandReadsAssigned:3570059 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207711 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207711-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,039,200 reads, 7,345,096 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR3207711.ke.tsv 34699 SRR3207711.se.tsv 87100 total ==> SRR3207711.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 252 26.0791 Potri.005G024800.1.v4.1 1035 936 50 10.6087 Potri.004G059700.1.v4.1 961 862 8 1.84311 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 176.828 12.3478 Potri.016G087400.1.v4.1 270 171 317 368.155 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 38.6929 4.59033 Potri.012G127500.1.v4.1 977 878 2093 473.416 ==> SRR3207711.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1122 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 91 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207711 completed mapping pipeline successfully