Starting /dee2/code/volunteer_pipeline.sh SRR3207712 current disk space = 3059104288768 free memory = 1153173076 SRR3207712 SRAfilesize d45b1c7652291c1eba08d37212611cce SRR3207712.sra SRR3207712.sra file validated SRR3207712 is single end SRR3207712 is conventional basespace SRR3207712 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207712_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.9905 39.0 36.0 40.0 33.0 40.0 2 36.684 39.0 36.0 40.0 31.0 40.0 3 36.59975 38.0 36.0 40.0 31.0 40.0 4 36.52 39.0 36.0 40.0 31.0 40.0 5 36.53175 39.0 36.0 40.0 31.0 40.0 6 36.6855 39.0 36.0 40.0 31.0 40.0 7 36.70025 39.0 36.0 40.0 32.0 40.0 8 36.643 38.0 36.0 40.0 31.0 40.0 9 36.4985 38.0 35.0 40.0 31.0 40.0 10 36.464 38.0 35.0 40.0 31.0 40.0 11 36.753 38.0 36.0 40.0 31.0 40.0 12 36.68025 38.0 36.0 40.0 31.0 40.0 13 36.37725 38.0 35.0 40.0 31.0 40.0 14 36.4465 38.0 35.0 40.0 31.0 40.0 15 36.2885 38.0 35.0 39.0 30.0 40.0 16 36.36725 38.0 35.0 40.0 31.0 40.0 17 36.10275 38.0 35.0 39.0 30.0 40.0 18 36.15775 38.0 35.0 39.0 30.0 40.0 19 36.11825 38.0 35.0 39.0 30.0 40.0 20 36.14925 38.0 35.0 39.0 30.0 40.0 21 36.093 38.0 35.0 39.0 30.0 40.0 22 36.369 38.0 35.0 39.0 31.0 40.0 23 35.96875 38.0 35.0 39.0 30.0 40.0 24 36.2055 38.0 35.0 39.0 30.0 40.0 25 36.07575 38.0 35.0 39.0 30.0 40.0 26 35.8195 38.0 35.0 39.0 29.0 40.0 27 35.61525 38.0 35.0 39.0 29.0 40.0 28 35.61675 38.0 35.0 39.0 29.0 40.0 29 35.315 38.0 34.0 39.0 28.0 40.0 30 35.3335 38.0 34.0 39.0 28.0 40.0 31 35.13025 38.0 34.0 39.0 27.0 40.0 32 34.68975 38.0 33.0 39.0 26.0 40.0 33 34.8175 38.0 33.0 39.0 27.0 40.0 34 34.40525 38.0 33.0 39.0 26.0 40.0 35 34.62625 38.0 33.0 39.0 27.0 40.0 36 34.6535 38.0 33.0 39.0 27.0 40.0 37 34.1815 37.0 33.0 39.0 25.0 40.0 38 34.324 38.0 33.0 39.0 26.0 40.0 39 34.228 38.0 33.0 39.0 26.0 40.0 40 33.9225 37.0 33.0 39.0 25.0 40.0 41 34.0315 37.0 33.0 39.0 25.0 40.0 42 34.1235 37.0 33.0 39.0 26.0 40.0 43 34.24075 37.0 33.0 39.0 26.0 40.0 44 33.85025 37.0 32.0 39.0 25.0 40.0 45 34.15075 37.0 33.0 39.0 26.0 40.0 46 34.1075 37.0 33.0 39.0 26.0 40.0 47 33.792 36.0 33.0 39.0 25.0 40.0 48 33.697 36.0 32.0 39.0 25.0 40.0 49 33.53725 36.0 32.0 39.0 24.0 40.0 50 33.44425 36.0 32.0 39.0 23.0 40.0 51 33.313 36.0 32.0 39.0 23.0 40.0 52 33.2475 36.0 32.0 39.0 23.0 40.0 53 32.96275 36.0 32.0 39.0 23.0 40.0 54 32.47325 36.0 31.0 38.0 22.0 40.0 55 32.34775 35.0 31.0 38.0 22.0 40.0 56 32.5115 36.0 32.0 39.0 21.0 40.0 57 31.8795 35.0 30.0 38.0 18.0 40.0 58 31.871 35.0 30.0 38.0 19.0 39.0 59 31.27575 35.0 30.0 38.0 17.0 39.0 60 31.4045 35.0 30.0 38.0 17.0 39.0 61 30.9905 35.0 30.0 38.0 9.0 39.0 62 30.6035 35.0 29.0 38.0 8.0 39.0 63 30.553 35.0 29.0 38.0 2.0 39.0 64 30.15375 34.0 29.0 38.0 2.0 39.0 65 30.13625 34.0 29.0 38.0 2.0 39.0 66 29.77975 35.0 29.0 38.0 2.0 39.0 67 29.36725 34.0 28.0 38.0 2.0 39.0 68 29.2975 34.0 28.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 1.0 5 0.0 6 2.0 7 2.0 8 1.0 9 7.0 10 7.0 11 10.0 12 10.0 13 12.0 14 10.0 15 14.0 16 10.0 17 15.0 18 18.0 19 13.0 20 24.0 21 23.0 22 26.0 23 29.0 24 37.0 25 49.0 26 49.0 27 73.0 28 89.0 29 77.0 30 95.0 31 132.0 32 160.0 33 214.0 34 272.0 35 364.0 36 419.0 37 597.0 38 678.0 39 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.182509505703422 16.14702154626109 16.400506970849175 43.26996197718631 2 18.099999999999998 26.8 37.6 17.5 3 20.225 30.45 26.75 22.575 4 24.075 33.725 21.2 21.0 5 25.624999999999996 36.275 22.3 15.8 6 17.8 37.125 25.374999999999996 19.7 7 15.775 17.95 45.125 21.15 8 18.3 22.6 31.175000000000004 27.925 9 20.825 21.95 32.6 24.625 10 20.125 39.5 24.375 16.0 11 25.124999999999996 29.049999999999997 20.275000000000002 25.55 12 19.925 25.0 28.249999999999996 26.825 13 19.025 29.325000000000003 30.275000000000002 21.375 14 20.125 27.400000000000002 30.775000000000002 21.7 15 21.525 27.925 29.799999999999997 20.75 16 21.775 27.150000000000002 28.225 22.85 17 22.400000000000002 28.1 27.075 22.425 18 22.775000000000002 27.775 28.799999999999997 20.65 19 20.95 29.975 26.875 22.2 20 21.075 29.549999999999997 27.725 21.65 21 21.125 28.875 27.55 22.45 22 21.625 28.375 27.925 22.075 23 20.674999999999997 28.499999999999996 28.749999999999996 22.075 24 22.225 29.049999999999997 27.375 21.349999999999998 25 21.45 30.375000000000004 27.250000000000004 20.925 26 21.03551775887944 28.23911955977989 28.714357178589296 22.011005502751377 27 21.725 28.249999999999996 27.55 22.475 28 21.525 30.0 25.974999999999998 22.5 29 22.05 29.599999999999998 27.275 21.075 30 22.35 29.25 28.225 20.175 31 21.325 29.725 27.425 21.525 32 22.025 28.975 26.8 22.2 33 21.125 30.025000000000002 27.900000000000002 20.95 34 21.8 28.299999999999997 27.875 22.025 35 21.375 28.9 28.95 20.775 36 21.525 27.3 27.775 23.400000000000002 37 21.55 29.375 27.375 21.7 38 22.825 29.049999999999997 26.650000000000002 21.475 39 20.625 29.125 28.975 21.275 40 22.075 28.499999999999996 27.700000000000003 21.725 41 21.575 28.549999999999997 27.575 22.3 42 21.2 27.975 29.025000000000002 21.8 43 21.5 28.325 28.9 21.275 44 22.900000000000002 28.425 28.1 20.575 45 21.15 28.825 28.749999999999996 21.275 46 20.75 28.025 28.075 23.150000000000002 47 20.875 29.75 28.4 20.974999999999998 48 20.724999999999998 28.9 28.599999999999998 21.775 49 21.85 28.625 27.85 21.675 50 20.7 28.325 29.2 21.775 51 21.65 29.025000000000002 27.6 21.725 52 22.275 28.65 26.950000000000003 22.125 53 20.674999999999997 28.599999999999998 28.95 21.775 54 22.375 28.65 27.85 21.125 55 20.525 29.975 28.000000000000004 21.5 56 21.125 28.249999999999996 29.549999999999997 21.075 57 22.025 28.349999999999998 28.599999999999998 21.025 58 21.425 27.775 29.775000000000002 21.025 59 21.975 28.050000000000004 27.950000000000003 22.025 60 20.599999999999998 28.275 28.999999999999996 22.125 61 22.125 28.849999999999998 28.199999999999996 20.825 62 21.175 29.125 27.250000000000004 22.45 63 21.099999999999998 28.475 28.1 22.325 64 21.65 28.7 28.125 21.525 65 20.775 28.725 29.025000000000002 21.475 66 21.575 27.85 27.750000000000004 22.825 67 21.75 28.925 27.85 21.475 68 22.2 27.700000000000003 28.925 21.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 2.5 19 3.0 20 3.0 21 3.5 22 4.0 23 6.0 24 10.5 25 13.0 26 18.0 27 24.0 28 25.0 29 35.5 30 59.0 31 72.0 32 85.5 33 115.0 34 131.0 35 139.5 36 172.5 37 197.0 38 229.5 39 276.5 40 297.5 41 304.0 42 328.5 43 363.5 44 374.0 45 349.5 46 311.5 47 298.0 48 273.0 49 234.0 50 220.0 51 193.0 52 148.5 53 131.0 54 106.5 55 68.0 56 54.0 57 44.0 58 28.5 59 23.0 60 21.0 61 13.0 62 7.0 63 6.5 64 7.0 65 7.0 66 6.0 67 3.5 68 2.5 69 4.0 70 2.5 71 2.5 72 4.0 73 2.5 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.05 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274504 spots for SRR3207712.sra Written 274504 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra Read 274485 spots for SRR3207712.sra Written 274485 spots for SRR3207712.sra SRR ids: ['SRR3207712.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0z0d5zcn SRR3207712.sra spots: 5489719 blocks: [[1, 274485], [274486, 548970], [548971, 823455], [823456, 1097940], [1097941, 1372425], [1372426, 1646910], [1646911, 1921395], [1921396, 2195880], [2195881, 2470365], [2470366, 2744850], [2744851, 3019335], [3019336, 3293820], [3293821, 3568305], [3568306, 3842790], [3842791, 4117275], [4117276, 4391760], [4391761, 4666245], [4666246, 4940730], [4940731, 5215215], [5215216, 5489719]] SRR3207712 file size 1152502 SRR3207712 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207712 SRR3207712_1.fastq Input file: SRR3207712_1.fastq trimmed: SRR3207712-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:27:05 2025 >> started Mon Feb 10 15:27:08 2025 >> done (2.745s) 5489719 reads processed; of these: 13096 ( 0.24%) short reads filtered out after trimming by size control 13441 ( 0.24%) empty reads filtered out after trimming by size control 5463182 (99.52%) reads available; of these: 439249 ( 8.04%) trimmed reads available after processing 5023933 (91.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1398 0.03% 19 2035 0.04% 20 3075 0.06% 21 1060 0.02% 22 1572 0.03% 23 2439 0.04% 24 3954 0.07% 25 6126 0.11% 26 1785 0.03% 27 2342 0.04% 28 3057 0.06% 29 5005 0.09% 30 7880 0.14% 31 1993 0.04% 32 2466 0.05% 33 3525 0.06% 34 4972 0.09% 35 7519 0.14% 36 1970 0.04% 37 2539 0.05% 38 3429 0.06% 39 5089 0.09% 40 7720 0.14% 41 1986 0.04% 42 2883 0.05% 43 4209 0.08% 44 6473 0.12% 45 10195 0.19% 46 2601 0.05% 47 3646 0.07% 48 5515 0.10% 49 9432 0.17% 50 15287 0.28% 51 3967 0.07% 52 5920 0.11% 53 8816 0.16% 54 14687 0.27% 55 26865 0.49% 56 5674 0.10% 57 8396 0.15% 58 12660 0.23% 59 21298 0.39% 60 39142 0.72% 61 7814 0.14% 62 11085 0.20% 63 17533 0.32% 64 31061 0.57% 65 50445 0.92% 66 10926 0.20% 67 17783 0.33% 68 5023933 91.96% 5463182 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=141.36 fanout-score-rank=6 prefix-density=0.25 prefix-fanout=18.5 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=15 fanout-score=228.89 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=22.9 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:27:23 Started mapping on | Feb 10 15:27:23 Finished on | Feb 10 15:27:29 Mapping speed, Million of reads per hour | 3277.91 Number of input reads | 5463182 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5112253 Uniquely mapped reads % | 93.58% Average mapped length | 66.73 Number of splices: Total | 961900 Number of splices: Annotated (sjdb) | 945220 Number of splices: GT/AG | 946313 Number of splices: GC/AG | 12896 Number of splices: AT/AC | 1177 Number of splices: Non-canonical | 1514 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202117 % of reads mapped to multiple loci | 3.70% Number of reads mapped to too many loci | 117895 % of reads mapped to too many loci | 2.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 148812 148812 148812 N_multimapping 202117 202117 202117 N_noFeature 259288 2649440 2692282 N_ambiguous 46745 8621 8387 UnstrandedReadsAssigned:4806220 PositiveStrandReadsAssigned:2454192 NegativeStrandReadsAssigned:2411584 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207712 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207712-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,463,182 reads, 5,017,359 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR3207712.ke.tsv 34699 SRR3207712.se.tsv 87100 total ==> SRR3207712.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 281 40.8902 Potri.005G024800.1.v4.1 1035 936 132 39.3809 Potri.004G059700.1.v4.1 961 862 7 2.26766 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 129.21 12.6869 Potri.016G087400.1.v4.1 270 171 190 310.274 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 54.7371 9.13091 Potri.012G127500.1.v4.1 977 878 1006 319.957 ==> SRR3207712.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 594 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 93 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207712 completed mapping pipeline successfully