Starting /dee2/code/volunteer_pipeline.sh SRR3207713 current disk space = 3058982625280 free memory = 1014872332 SRR3207713 SRAfilesize 65db19177a5a8b8abf27ce2a96707a91 SRR3207713.sra SRR3207713.sra file validated SRR3207713 is single end SRR3207713 is conventional basespace SRR3207713 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207713_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.626 38.0 36.0 39.0 32.0 40.0 2 36.38 38.0 35.0 39.0 30.0 40.0 3 36.22975 38.0 35.0 39.0 30.0 40.0 4 36.227 38.0 35.0 39.0 30.0 40.0 5 36.244 38.0 35.0 39.0 30.0 40.0 6 36.17725 38.0 35.0 39.0 29.0 40.0 7 36.56525 38.0 36.0 39.0 31.0 40.0 8 36.41825 38.0 35.0 39.0 31.0 40.0 9 36.17725 38.0 35.0 39.0 30.0 40.0 10 36.0375 38.0 35.0 39.0 29.0 40.0 11 36.40425 38.0 35.0 39.0 31.0 40.0 12 36.284 38.0 35.0 39.0 30.0 40.0 13 36.2595 38.0 35.0 39.0 30.0 40.0 14 36.1025 38.0 35.0 39.0 30.0 40.0 15 36.0685 38.0 35.0 39.0 30.0 40.0 16 36.08325 38.0 35.0 39.0 30.0 40.0 17 36.12425 38.0 35.0 39.0 30.0 40.0 18 35.83325 38.0 35.0 39.0 29.0 40.0 19 35.79375 38.0 35.0 39.0 29.0 40.0 20 35.7905 38.0 35.0 39.0 29.0 40.0 21 36.04675 38.0 35.0 39.0 30.0 40.0 22 35.98425 38.0 35.0 39.0 30.0 40.0 23 35.69675 38.0 35.0 39.0 29.0 40.0 24 35.74375 38.0 35.0 39.0 29.0 40.0 25 35.62825 38.0 35.0 39.0 29.0 40.0 26 35.4215 38.0 35.0 39.0 29.0 40.0 27 35.4305 38.0 35.0 39.0 29.0 40.0 28 35.0885 38.0 33.0 39.0 27.0 40.0 29 35.297 38.0 34.0 39.0 29.0 40.0 30 34.911 38.0 33.0 39.0 27.0 40.0 31 34.94625 38.0 33.0 39.0 28.0 40.0 32 34.712 38.0 33.0 39.0 27.0 40.0 33 34.1915 38.0 33.0 39.0 25.0 40.0 34 34.067 37.0 33.0 39.0 25.0 40.0 35 33.93875 37.0 32.0 39.0 25.0 40.0 36 34.282 38.0 33.0 39.0 26.0 40.0 37 34.2225 37.0 33.0 39.0 26.0 40.0 38 33.91325 37.0 33.0 39.0 25.0 40.0 39 33.97625 37.0 33.0 39.0 26.0 40.0 40 33.65925 36.0 32.0 39.0 24.0 40.0 41 33.91375 37.0 33.0 39.0 25.0 40.0 42 33.757 37.0 33.0 39.0 25.0 40.0 43 33.539 36.0 32.0 39.0 24.0 40.0 44 33.2675 36.0 32.0 39.0 23.0 40.0 45 33.327 36.0 32.0 39.0 23.0 40.0 46 33.367 36.0 32.0 39.0 23.0 40.0 47 33.28 36.0 32.0 39.0 23.0 40.0 48 33.069 36.0 31.0 39.0 23.0 40.0 49 33.0815 36.0 32.0 39.0 23.0 40.0 50 32.5525 36.0 31.0 38.0 22.0 40.0 51 32.40425 36.0 31.0 38.0 21.0 40.0 52 32.44475 36.0 31.0 38.0 22.0 40.0 53 31.9545 35.0 30.0 38.0 18.0 39.0 54 31.45575 35.0 30.0 38.0 18.0 39.0 55 31.552 35.0 30.0 38.0 17.0 39.0 56 31.2115 35.0 30.0 38.0 14.0 39.0 57 31.01075 35.0 30.0 38.0 12.0 39.0 58 30.7515 35.0 29.0 38.0 11.0 39.0 59 30.586 35.0 29.0 38.0 10.0 39.0 60 30.13925 34.0 29.0 38.0 2.0 39.0 61 29.59825 34.0 28.0 37.0 2.0 39.0 62 29.70225 34.0 29.0 37.0 2.0 39.0 63 29.655 34.0 29.0 37.0 2.0 39.0 64 29.39675 34.0 28.0 37.0 2.0 39.0 65 29.04 33.0 28.0 37.0 2.0 39.0 66 28.419 33.0 27.0 37.0 2.0 39.0 67 28.27775 33.0 27.0 37.0 2.0 39.0 68 27.68075 33.0 25.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 1.0 4 2.0 5 2.0 6 3.0 7 4.0 8 5.0 9 8.0 10 11.0 11 11.0 12 11.0 13 13.0 14 18.0 15 16.0 16 11.0 17 12.0 18 16.0 19 24.0 20 12.0 21 27.0 22 32.0 23 29.0 24 50.0 25 65.0 26 86.0 27 83.0 28 90.0 29 96.0 30 112.0 31 126.0 32 147.0 33 203.0 34 293.0 35 386.0 36 487.0 37 572.0 38 611.0 39 310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.809547993905536 16.42965972574911 16.09954291518537 42.66124936515998 2 18.9 25.874999999999996 37.95 17.275 3 21.8 28.775000000000002 26.85 22.575 4 23.849999999999998 34.75 20.974999999999998 20.424999999999997 5 23.95 35.925000000000004 23.075000000000003 17.05 6 18.425 38.025 24.875 18.675 7 15.85 17.849999999999998 46.0 20.3 8 18.35 22.35 30.4 28.9 9 18.15 22.400000000000002 32.824999999999996 26.625 10 20.3 37.824999999999996 24.2 17.675 11 25.074999999999996 27.575 21.825 25.525 12 20.275000000000002 24.425 29.125 26.174999999999997 13 19.625 28.349999999999998 32.300000000000004 19.725 14 20.575 27.975 29.875 21.575 15 21.025 28.225 28.975 21.775 16 21.625 28.375 27.425 22.575 17 21.955488872218055 29.707426856714182 27.431857964491122 20.905226306576644 18 21.175 27.474999999999998 29.025000000000002 22.325 19 21.45 28.15 27.775 22.625 20 21.05 28.525 28.875 21.55 21 20.849999999999998 27.750000000000004 29.049999999999997 22.35 22 21.5 28.449999999999996 28.125 21.925 23 22.275 29.175 28.225 20.325 24 20.200000000000003 29.5 28.749999999999996 21.55 25 21.0 27.700000000000003 28.7 22.6 26 20.9 31.324999999999996 27.200000000000003 20.575 27 21.25 27.700000000000003 28.275 22.775000000000002 28 21.85 29.125 27.875 21.15 29 21.625 28.749999999999996 28.175 21.45 30 20.1 29.4 27.750000000000004 22.75 31 19.975 29.475 28.575 21.975 32 22.425 28.125 27.875 21.575 33 20.775 29.125 28.325 21.775 34 22.0 28.050000000000004 27.800000000000004 22.15 35 21.925 28.375 28.599999999999998 21.099999999999998 36 21.349999999999998 28.65 27.500000000000004 22.5 37 20.225 29.45 28.975 21.349999999999998 38 21.525 28.299999999999997 28.075 22.1 39 20.330082520630157 28.582145536384097 28.632158039509875 22.455613903475868 40 21.405351337834457 28.80720180045011 29.057264316079017 20.730182545636406 41 22.025 28.449999999999996 28.375 21.15 42 21.2 28.825 28.125 21.85 43 20.7 28.7 28.9 21.7 44 22.400000000000002 29.175 28.15 20.275000000000002 45 21.85 28.475 27.224999999999998 22.45 46 20.825 29.549999999999997 28.825 20.8 47 21.55 28.799999999999997 28.275 21.375 48 21.0 29.349999999999998 28.1 21.55 49 21.075 28.549999999999997 28.599999999999998 21.775 50 20.599999999999998 29.575000000000003 29.099999999999998 20.724999999999998 51 21.65 29.975 27.400000000000002 20.974999999999998 52 21.725 27.6 29.7 20.974999999999998 53 22.1 30.025000000000002 27.0 20.875 54 21.725 29.125 27.0 22.15 55 21.55 28.025 29.075 21.349999999999998 56 22.55 27.425 27.325 22.7 57 20.549999999999997 29.049999999999997 27.725 22.675 58 20.375 29.15 29.325000000000003 21.15 59 22.025 27.275 29.65 21.05 60 20.349999999999998 27.700000000000003 29.299999999999997 22.650000000000002 61 22.35 27.825 28.349999999999998 21.475 62 22.525000000000002 27.875 27.474999999999998 22.125 63 21.6 29.9 27.075 21.425 64 21.75 27.825 28.275 22.15 65 21.625 30.025000000000002 26.8 21.55 66 21.925 28.425 28.875 20.775 67 22.85 27.075 28.599999999999998 21.475 68 22.3 28.025 28.15 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.5 19 5.0 20 5.0 21 7.5 22 10.0 23 10.5 24 11.5 25 12.0 26 18.0 27 24.0 28 24.0 29 34.5 30 56.5 31 68.0 32 84.0 33 113.0 34 126.0 35 143.5 36 178.0 37 195.0 38 224.5 39 281.5 40 317.0 41 325.0 42 332.5 43 339.5 44 339.0 45 342.5 46 314.0 47 282.0 48 270.0 49 233.0 50 208.0 51 190.5 52 141.0 53 109.0 54 103.5 55 72.0 56 46.0 57 43.5 58 35.5 59 30.0 60 22.0 61 13.0 62 12.0 63 10.0 64 7.0 65 5.0 66 4.0 67 4.0 68 3.0 69 2.0 70 1.0 71 0.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.025 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.025 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303331 spots for SRR3207713.sra Written 303331 spots for SRR3207713.sra Read 303334 spots for SRR3207713.sra Written 303334 spots for SRR3207713.sra SRR ids: ['SRR3207713.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3r_2hfp0 SRR3207713.sra spots: 6066623 blocks: [[1, 303331], [303332, 606662], [606663, 909993], [909994, 1213324], [1213325, 1516655], [1516656, 1819986], [1819987, 2123317], [2123318, 2426648], [2426649, 2729979], [2729980, 3033310], [3033311, 3336641], [3336642, 3639972], [3639973, 3943303], [3943304, 4246634], [4246635, 4549965], [4549966, 4853296], [4853297, 5156627], [5156628, 5459958], [5459959, 5763289], [5763290, 6066623]] SRR3207713 file size 1273708 SRR3207713 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207713 SRR3207713_1.fastq Input file: SRR3207713_1.fastq trimmed: SRR3207713-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:35:08 2025 >> started Mon Feb 10 15:35:11 2025 >> done (2.997s) 6066623 reads processed; of these: 16026 ( 0.26%) short reads filtered out after trimming by size control 8556 ( 0.14%) empty reads filtered out after trimming by size control 6042041 (99.59%) reads available; of these: 505470 ( 8.37%) trimmed reads available after processing 5536571 (91.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1715 0.03% 19 2503 0.04% 20 3861 0.06% 21 1215 0.02% 22 1717 0.03% 23 2777 0.05% 24 4670 0.08% 25 8019 0.13% 26 2051 0.03% 27 2892 0.05% 28 3588 0.06% 29 6098 0.10% 30 9003 0.15% 31 2257 0.04% 32 3073 0.05% 33 3924 0.06% 34 5799 0.10% 35 8490 0.14% 36 2183 0.04% 37 2963 0.05% 38 3854 0.06% 39 6050 0.10% 40 8944 0.15% 41 2422 0.04% 42 3293 0.05% 43 4973 0.08% 44 7734 0.13% 45 12146 0.20% 46 2920 0.05% 47 4221 0.07% 48 6584 0.11% 49 10907 0.18% 50 17453 0.29% 51 4325 0.07% 52 6825 0.11% 53 10130 0.17% 54 17122 0.28% 55 31201 0.52% 56 6590 0.11% 57 9492 0.16% 58 14451 0.24% 59 24763 0.41% 60 44132 0.73% 61 9020 0.15% 62 12882 0.21% 63 20075 0.33% 64 35310 0.58% 65 56748 0.94% 66 12447 0.21% 67 19658 0.33% 68 5536571 91.63% 6042041 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=111.89 fanout-score-rank=5 prefix-density=0.22 prefix-fanout=18.2 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=12 fanout-score=199.33 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=21.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:35:26 Started mapping on | Feb 10 15:35:27 Finished on | Feb 10 15:35:33 Mapping speed, Million of reads per hour | 3625.22 Number of input reads | 6042041 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5693335 Uniquely mapped reads % | 94.23% Average mapped length | 66.66 Number of splices: Total | 989983 Number of splices: Annotated (sjdb) | 971316 Number of splices: GT/AG | 974134 Number of splices: GC/AG | 12880 Number of splices: AT/AC | 1306 Number of splices: Non-canonical | 1663 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198512 % of reads mapped to multiple loci | 3.29% Number of reads mapped to too many loci | 119021 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 150194 150194 150194 N_multimapping 198512 198512 198512 N_noFeature 342633 2978157 3021381 N_ambiguous 55295 9267 9660 UnstrandedReadsAssigned:5295407 PositiveStrandReadsAssigned:2705911 NegativeStrandReadsAssigned:2662294 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207713 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207713-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,042,041 reads, 5,489,158 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR3207713.ke.tsv 34699 SRR3207713.se.tsv 87100 total ==> SRR3207713.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 243.511 34.0644 Potri.005G024800.1.v4.1 1035 936 118.027 33.8501 Potri.004G059700.1.v4.1 961 862 11 3.42564 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 121.876 11.5039 Potri.016G087400.1.v4.1 270 171 200 313.972 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 26.6563 4.27466 Potri.012G127500.1.v4.1 977 878 716 218.915 ==> SRR3207713.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1015 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 93 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207713 completed mapping pipeline successfully