Starting /dee2/code/volunteer_pipeline.sh SRR3207714 current disk space = 3058961555456 free memory = 1157184016 SRR3207714 SRAfilesize 3766fc5fab46d26ed84d5d90dd401359 SRR3207714.sra SRR3207714.sra file validated SRR3207714 is single end SRR3207714 is conventional basespace SRR3207714 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207714_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.75925 38.0 36.0 40.0 33.0 40.0 2 36.4355 38.0 36.0 40.0 31.0 40.0 3 36.26525 38.0 35.0 39.0 30.0 40.0 4 36.3825 38.0 36.0 39.0 31.0 40.0 5 36.357 38.0 35.0 39.0 31.0 40.0 6 36.24275 38.0 35.0 39.0 30.0 40.0 7 36.5745 38.0 36.0 39.0 31.0 40.0 8 36.39475 38.0 35.0 40.0 31.0 40.0 9 36.2355 38.0 35.0 39.0 30.0 40.0 10 36.157 38.0 35.0 39.0 30.0 40.0 11 36.43075 38.0 35.0 39.0 31.0 40.0 12 36.1945 38.0 35.0 39.0 30.0 40.0 13 36.2425 38.0 35.0 39.0 30.0 40.0 14 36.05275 38.0 35.0 39.0 30.0 40.0 15 36.06375 38.0 35.0 39.0 30.0 40.0 16 36.153 38.0 35.0 39.0 30.0 40.0 17 36.173 38.0 35.0 39.0 30.0 40.0 18 35.9465 38.0 35.0 39.0 30.0 40.0 19 35.835 38.0 35.0 39.0 29.0 40.0 20 35.80375 38.0 35.0 39.0 29.0 40.0 21 36.0805 38.0 35.0 39.0 30.0 40.0 22 35.9855 38.0 35.0 39.0 30.0 40.0 23 35.94075 38.0 35.0 39.0 30.0 40.0 24 35.79125 38.0 35.0 39.0 29.0 40.0 25 35.64675 38.0 35.0 39.0 29.0 40.0 26 35.5105 38.0 35.0 39.0 29.0 40.0 27 35.41925 38.0 34.0 39.0 29.0 40.0 28 35.1965 38.0 34.0 39.0 28.0 40.0 29 35.38075 38.0 35.0 39.0 28.0 40.0 30 35.047 38.0 33.0 39.0 28.0 40.0 31 35.092 38.0 34.0 39.0 28.0 40.0 32 34.8265 38.0 33.0 39.0 27.0 40.0 33 34.3715 38.0 33.0 39.0 26.0 40.0 34 34.3695 37.0 33.0 39.0 26.0 40.0 35 34.056 37.0 33.0 39.0 25.0 40.0 36 34.322 38.0 33.0 39.0 26.0 40.0 37 34.14175 37.0 33.0 39.0 25.0 40.0 38 33.98575 37.0 33.0 39.0 24.0 40.0 39 34.16675 37.0 33.0 39.0 26.0 40.0 40 33.6515 36.0 32.0 39.0 23.0 40.0 41 33.94175 37.0 33.0 39.0 25.0 40.0 42 33.76425 36.0 33.0 39.0 25.0 40.0 43 33.455 36.0 32.0 39.0 24.0 40.0 44 33.42425 36.0 32.0 39.0 23.0 40.0 45 33.3945 36.0 32.0 39.0 23.0 40.0 46 33.32325 36.0 32.0 39.0 23.0 40.0 47 33.27075 36.0 32.0 39.0 23.0 40.0 48 33.02575 36.0 31.0 39.0 23.0 40.0 49 32.9925 36.0 31.0 39.0 23.0 40.0 50 32.57475 36.0 31.0 38.0 23.0 40.0 51 32.4295 36.0 31.0 39.0 20.0 40.0 52 32.48675 36.0 31.0 38.0 22.0 40.0 53 31.95975 35.0 30.0 38.0 19.0 39.0 54 31.52925 35.0 30.0 38.0 18.0 39.0 55 31.67925 35.0 30.0 38.0 18.0 39.0 56 31.271 35.0 30.0 38.0 15.0 39.0 57 31.145 35.0 30.0 38.0 14.0 39.0 58 30.917 35.0 30.0 38.0 13.0 39.0 59 30.6565 35.0 29.0 38.0 10.0 39.0 60 30.28525 35.0 29.0 38.0 2.0 39.0 61 29.6605 34.0 28.0 38.0 2.0 39.0 62 29.7735 34.0 28.0 38.0 2.0 39.0 63 29.77425 34.0 29.0 38.0 2.0 39.0 64 29.4885 34.0 28.0 37.0 2.0 39.0 65 29.0685 33.0 28.0 37.0 2.0 39.0 66 28.6385 34.0 27.0 37.0 2.0 39.0 67 28.404 33.0 27.0 37.0 2.0 39.0 68 27.99825 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 2.0 5 5.0 6 1.0 7 3.0 8 4.0 9 10.0 10 6.0 11 6.0 12 13.0 13 14.0 14 7.0 15 16.0 16 17.0 17 15.0 18 14.0 19 25.0 20 29.0 21 37.0 22 24.0 23 44.0 24 36.0 25 61.0 26 67.0 27 78.0 28 86.0 29 94.0 30 105.0 31 124.0 32 160.0 33 206.0 34 269.0 35 375.0 36 493.0 37 557.0 38 650.0 39 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.778171689035197 16.865029121296534 16.33324892377817 43.0235502658901 2 18.0 27.224999999999998 37.125 17.65 3 20.775 29.599999999999998 27.125 22.5 4 24.099999999999998 33.800000000000004 20.175 21.925 5 24.6 36.275 22.175 16.950000000000003 6 18.0 37.75 24.725 19.525000000000002 7 15.425 16.775000000000002 46.6 21.2 8 18.224999999999998 22.400000000000002 30.275000000000002 29.099999999999998 9 20.599999999999998 23.075000000000003 31.474999999999998 24.85 10 19.675 39.875 22.8 17.65 11 26.525 26.474999999999998 20.75 26.25 12 20.4 24.125 29.525000000000002 25.95 13 18.575 28.775000000000002 31.8 20.849999999999998 14 21.125 27.3 28.7 22.875 15 20.025000000000002 28.95 28.449999999999996 22.575 16 20.424999999999997 28.499999999999996 28.375 22.7 17 22.725 27.950000000000003 27.025 22.3 18 21.85 28.15 28.275 21.725 19 21.0 28.349999999999998 28.599999999999998 22.05 20 21.65 28.449999999999996 26.775 23.125 21 22.45 29.775000000000002 27.150000000000002 20.625 22 21.625 30.125 28.000000000000004 20.25 23 21.45 29.575000000000003 28.025 20.95 24 20.200000000000003 28.9 28.799999999999997 22.1 25 21.075 28.975 27.875 22.075 26 21.975 28.125 28.599999999999998 21.3 27 21.224999999999998 29.15 28.299999999999997 21.325 28 22.025 28.799999999999997 27.85 21.325 29 21.725 28.725 28.625 20.925 30 20.549999999999997 28.475 28.725 22.25 31 20.349999999999998 28.599999999999998 29.525000000000002 21.525 32 20.775 29.65 27.725 21.85 33 21.675 28.575 27.700000000000003 22.05 34 19.975 29.4 28.475 22.15 35 21.5 29.375 27.175 21.95 36 21.725 29.65 26.8 21.825 37 22.675 28.975 27.775 20.575 38 21.675 28.9 27.425 22.0 39 22.15 27.925 28.625 21.3 40 22.075 28.475 27.700000000000003 21.75 41 21.9 28.050000000000004 27.474999999999998 22.575 42 21.5 29.2 28.325 20.974999999999998 43 22.325 27.425 29.4 20.849999999999998 44 21.725 28.499999999999996 28.425 21.349999999999998 45 21.525 28.225 28.025 22.225 46 21.525 29.349999999999998 28.299999999999997 20.825 47 21.925 29.599999999999998 27.175 21.3 48 20.25 28.599999999999998 29.2 21.95 49 21.0 28.299999999999997 28.075 22.625 50 20.325 28.575 28.7 22.400000000000002 51 21.349999999999998 27.075 28.849999999999998 22.725 52 22.05 27.925 27.900000000000002 22.125 53 20.9 29.675 28.299999999999997 21.125 54 21.025 28.9 28.95 21.125 55 21.575 28.199999999999996 28.9 21.325 56 22.125 27.775 28.199999999999996 21.9 57 20.7 30.099999999999998 27.3 21.9 58 21.125 28.7 29.25 20.925 59 22.025 28.299999999999997 28.025 21.65 60 22.0 27.474999999999998 27.925 22.6 61 21.05 29.15 29.2 20.599999999999998 62 21.8 29.25 28.199999999999996 20.75 63 22.025 27.725 27.425 22.825 64 20.724999999999998 28.549999999999997 28.95 21.775 65 22.400000000000002 29.2 27.725 20.674999999999997 66 21.975 28.675 27.825 21.525 67 22.325 27.975 27.800000000000004 21.9 68 20.7 30.825000000000003 27.250000000000004 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.5 18 2.0 19 2.0 20 2.5 21 4.5 22 6.0 23 6.5 24 9.5 25 12.0 26 17.5 27 23.5 28 24.0 29 34.0 30 53.5 31 63.0 32 89.5 33 128.5 34 141.0 35 147.0 36 177.5 37 202.0 38 219.0 39 248.0 40 297.0 41 334.0 42 335.5 43 340.5 44 344.0 45 340.5 46 315.0 47 293.0 48 281.0 49 245.5 50 222.0 51 214.0 52 165.5 53 125.0 54 99.0 55 62.5 56 52.0 57 45.0 58 29.5 59 21.0 60 20.0 61 13.0 62 7.0 63 8.0 64 6.0 65 4.0 66 5.0 67 4.5 68 3.5 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 1.0 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.4788306451612903 0.95 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.225 0.0 0.0 0.0 0.0 22 0.225 0.0 0.0 0.0 0.0 23 0.225 0.0 0.0 0.0 0.0 24 0.225 0.0 0.0 0.0 0.0 25 0.25 0.0 0.0 0.0 0.0 26 0.25 0.0 0.0 0.0 0.0 27 0.25 0.0 0.0 0.0 0.0 28 0.25 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.25 0.0 0.0 0.0 0.0 31 0.25 0.0 0.0 0.0 0.0 32 0.25 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.25 0.0 0.0 0.0 0.0 36 0.25 0.0 0.0 0.0 0.0 37 0.25 0.0 0.0 0.0 0.0 38 0.25 0.0 0.0 0.0 0.0 39 0.25 0.0 0.0 0.0 0.0 40 0.25 0.0 0.0 0.0 0.0 41 0.25 0.0 0.0 0.0 0.0 42 0.25 0.0 0.0 0.0 0.0 43 0.25 0.0 0.0 0.0 0.0 44 0.25 0.0 0.0 0.0 0.0 45 0.25 0.0 0.0 0.0 0.0 46 0.25 0.0 0.0 0.0 0.0 47 0.25 0.0 0.0 0.0 0.0 48 0.25 0.0 0.0 0.0 0.0 49 0.25 0.0 0.0 0.0 0.0 50 0.25 0.0 0.0 0.0 0.0 51 0.25 0.0 0.0 0.0 0.0 52 0.25 0.0 0.0 0.0 0.0 53 0.25 0.0 0.0 0.0 0.0 54 0.25 0.0 0.0 0.0 0.0 55 0.25 0.0 0.0 0.0 0.0 56 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307463 spots for SRR3207714.sra Written 307463 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra Read 307461 spots for SRR3207714.sra Written 307461 spots for SRR3207714.sra SRR ids: ['SRR3207714.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n7v3r0gr SRR3207714.sra spots: 6149222 blocks: [[1, 307461], [307462, 614922], [614923, 922383], [922384, 1229844], [1229845, 1537305], [1537306, 1844766], [1844767, 2152227], [2152228, 2459688], [2459689, 2767149], [2767150, 3074610], [3074611, 3382071], [3382072, 3689532], [3689533, 3996993], [3996994, 4304454], [4304455, 4611915], [4611916, 4919376], [4919377, 5226837], [5226838, 5534298], [5534299, 5841759], [5841760, 6149222]] SRR3207714 file size 1291067 SRR3207714 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207714 SRR3207714_1.fastq Input file: SRR3207714_1.fastq trimmed: SRR3207714-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 15:36:24 2025 >> started Mon Feb 10 15:36:27 2025 >> done (2.899s) 6149222 reads processed; of these: 16977 ( 0.28%) short reads filtered out after trimming by size control 42233 ( 0.69%) empty reads filtered out after trimming by size control 6090012 (99.04%) reads available; of these: 523754 ( 8.60%) trimmed reads available after processing 5566258 (91.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1871 0.03% 19 2782 0.05% 20 17025 0.28% 21 1600 0.03% 22 1867 0.03% 23 2723 0.04% 24 4854 0.08% 25 8132 0.13% 26 2692 0.04% 27 3019 0.05% 28 3677 0.06% 29 6203 0.10% 30 9086 0.15% 31 2344 0.04% 32 3098 0.05% 33 3959 0.07% 34 5928 0.10% 35 8707 0.14% 36 2288 0.04% 37 3048 0.05% 38 3981 0.07% 39 6043 0.10% 40 9020 0.15% 41 2454 0.04% 42 3265 0.05% 43 5063 0.08% 44 7790 0.13% 45 12486 0.21% 46 2931 0.05% 47 4257 0.07% 48 6463 0.11% 49 10905 0.18% 50 17719 0.29% 51 4486 0.07% 52 7030 0.12% 53 10040 0.16% 54 17142 0.28% 55 31496 0.52% 56 6627 0.11% 57 9356 0.15% 58 14561 0.24% 59 25008 0.41% 60 44178 0.73% 61 8953 0.15% 62 12701 0.21% 63 20231 0.33% 64 35560 0.58% 65 56788 0.93% 66 12412 0.20% 67 19905 0.33% 68 5566258 91.40% 6090012 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=39.38 fanout-score-rank=12 prefix-density=0.13 prefix-fanout=9.9 sequence=AGAAAGAAAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=219.40 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=22.4 sequence=TTCTTCTTCTTC Started job on | Feb 10 15:36:39 Started mapping on | Feb 10 15:36:40 Finished on | Feb 10 15:36:46 Mapping speed, Million of reads per hour | 3654.01 Number of input reads | 6090012 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5763968 Uniquely mapped reads % | 94.65% Average mapped length | 66.65 Number of splices: Total | 1041167 Number of splices: Annotated (sjdb) | 1022913 Number of splices: GT/AG | 1024915 Number of splices: GC/AG | 13263 Number of splices: AT/AC | 1287 Number of splices: Non-canonical | 1702 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222545 % of reads mapped to multiple loci | 3.65% Number of reads mapped to too many loci | 67346 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 103499 103499 103499 N_multimapping 222545 222545 222545 N_noFeature 310049 2995678 3041691 N_ambiguous 55359 9394 9386 UnstrandedReadsAssigned:5398560 PositiveStrandReadsAssigned:2758896 NegativeStrandReadsAssigned:2712891 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207714 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207714-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,090,012 reads, 5,559,595 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 972 rounds 52401 SRR3207714.ke.tsv 34699 SRR3207714.se.tsv 87100 total ==> SRR3207714.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 206 28.0905 Potri.005G024800.1.v4.1 1035 936 75 20.9678 Potri.004G059700.1.v4.1 961 862 14 4.25 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 113.649 10.4569 Potri.016G087400.1.v4.1 270 171 237 362.677 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 35 5.47117 Potri.012G127500.1.v4.1 977 878 956 284.925 ==> SRR3207714.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 797 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 85 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207714 completed mapping pipeline successfully