Starting /dee2/code/volunteer_pipeline.sh SRR3207715 current disk space = 3058666475520 free memory = 1564796796 SRR3207715 SRAfilesize cb9f6cc6af10839952b6fef7974916aa SRR3207715.sra SRR3207715.sra file validated SRR3207715 is single end SRR3207715 is conventional basespace SRR3207715 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207715_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.69625 38.0 36.0 40.0 31.0 40.0 2 36.41375 38.0 36.0 40.0 30.0 40.0 3 36.246 38.0 35.0 40.0 30.0 40.0 4 36.28075 38.0 35.0 40.0 30.0 40.0 5 36.3105 38.0 35.0 40.0 30.0 40.0 6 36.223 38.0 35.0 40.0 30.0 40.0 7 36.60225 39.0 36.0 40.0 31.0 40.0 8 36.37925 38.0 35.0 40.0 31.0 40.0 9 36.1395 38.0 35.0 40.0 30.0 40.0 10 36.10525 38.0 35.0 39.0 30.0 40.0 11 36.35075 38.0 35.0 39.0 30.0 40.0 12 36.21575 38.0 35.0 39.0 30.0 40.0 13 36.24425 38.0 35.0 39.0 30.0 40.0 14 36.00225 38.0 35.0 39.0 29.0 40.0 15 36.02175 38.0 35.0 39.0 29.0 40.0 16 36.09975 38.0 35.0 39.0 30.0 40.0 17 36.1215 38.0 35.0 39.0 30.0 40.0 18 35.86625 38.0 35.0 39.0 29.0 40.0 19 35.94325 38.0 35.0 39.0 30.0 40.0 20 35.80575 38.0 35.0 39.0 29.0 40.0 21 36.0475 38.0 35.0 39.0 30.0 40.0 22 36.0565 38.0 35.0 39.0 30.0 40.0 23 35.81075 38.0 35.0 39.0 29.0 40.0 24 35.8095 38.0 35.0 39.0 30.0 40.0 25 35.64425 38.0 35.0 39.0 29.0 40.0 26 35.46425 38.0 35.0 39.0 29.0 40.0 27 35.40725 38.0 35.0 39.0 29.0 40.0 28 35.01475 38.0 33.0 39.0 27.0 40.0 29 35.22375 38.0 34.0 39.0 28.0 40.0 30 34.89575 38.0 33.0 39.0 27.0 40.0 31 34.9365 38.0 34.0 39.0 27.0 40.0 32 34.79025 38.0 33.0 39.0 27.0 40.0 33 34.216 38.0 33.0 39.0 26.0 40.0 34 34.12675 37.0 33.0 39.0 25.0 40.0 35 33.98625 37.0 33.0 39.0 25.0 40.0 36 34.21525 38.0 33.0 39.0 25.0 40.0 37 34.0755 37.0 33.0 39.0 25.0 40.0 38 33.9415 37.0 33.0 39.0 24.0 40.0 39 33.9295 37.0 33.0 39.0 25.0 40.0 40 33.57575 36.0 33.0 39.0 23.0 40.0 41 33.814 37.0 33.0 39.0 25.0 40.0 42 33.642 37.0 33.0 39.0 24.0 40.0 43 33.3355 36.0 32.0 39.0 23.0 40.0 44 33.12525 36.0 31.0 39.0 23.0 40.0 45 33.35775 36.0 32.0 39.0 23.0 40.0 46 33.2755 36.0 33.0 39.0 23.0 40.0 47 33.18825 36.0 32.0 39.0 23.0 40.0 48 33.01875 36.0 32.0 39.0 23.0 40.0 49 32.8615 36.0 31.0 39.0 23.0 40.0 50 32.35425 36.0 31.0 38.0 21.0 40.0 51 32.441 36.0 32.0 39.0 19.0 40.0 52 32.40525 36.0 31.0 38.0 20.0 40.0 53 31.89975 35.0 31.0 38.0 18.0 39.0 54 31.5005 35.0 30.0 38.0 17.0 39.0 55 31.57275 35.0 30.0 38.0 16.0 39.0 56 31.0525 35.0 30.0 38.0 10.0 39.0 57 30.9625 35.0 29.0 38.0 10.0 39.0 58 30.63075 35.0 29.0 38.0 10.0 39.0 59 30.56425 35.0 29.0 38.0 2.0 39.0 60 30.116 34.0 29.0 38.0 2.0 39.0 61 29.6825 34.0 29.0 37.0 2.0 39.0 62 29.72075 34.0 29.0 38.0 2.0 39.0 63 29.7535 34.0 29.0 38.0 2.0 39.0 64 29.67525 34.0 29.0 38.0 2.0 39.0 65 29.125 34.0 27.0 37.0 2.0 39.0 66 28.75925 34.0 27.0 37.0 2.0 39.0 67 28.6235 33.0 27.0 37.0 2.0 39.0 68 28.079 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 2.0 4 1.0 5 3.0 6 3.0 7 4.0 8 7.0 9 6.0 10 8.0 11 9.0 12 18.0 13 17.0 14 11.0 15 13.0 16 17.0 17 22.0 18 17.0 19 10.0 20 21.0 21 28.0 22 36.0 23 40.0 24 39.0 25 60.0 26 72.0 27 67.0 28 93.0 29 85.0 30 106.0 31 126.0 32 159.0 33 203.0 34 267.0 35 361.0 36 461.0 37 604.0 38 627.0 39 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.41856925418569 15.854895991882293 15.702688990360222 43.023845763571785 2 18.925 26.450000000000003 37.475 17.150000000000002 3 21.325 29.225 26.875 22.575 4 23.75 35.375 21.025 19.85 5 24.425 37.65 22.175 15.75 6 17.224999999999998 37.35 26.5 18.925 7 16.1 17.125 45.175 21.6 8 18.675 22.7 30.875000000000004 27.750000000000004 9 19.325 22.900000000000002 33.175 24.6 10 19.325 38.95 23.75 17.974999999999998 11 25.05 28.125 20.474999999999998 26.35 12 20.175 25.624999999999996 28.15 26.05 13 18.475 29.375 31.65 20.5 14 21.325 27.975 28.999999999999996 21.7 15 21.275 28.025 27.525 23.175 16 21.125 28.975 27.55 22.35 17 21.45 30.075000000000003 26.775 21.7 18 20.474999999999998 30.0 27.250000000000004 22.275 19 21.8 29.15 27.474999999999998 21.575 20 21.349999999999998 29.299999999999997 27.900000000000002 21.45 21 21.575 29.099999999999998 28.199999999999996 21.125 22 22.275 28.675 27.075 21.975 23 21.55 29.849999999999998 27.375 21.224999999999998 24 21.075 30.5 27.700000000000003 20.724999999999998 25 21.375 28.65 28.050000000000004 21.925 26 21.625 29.849999999999998 27.575 20.95 27 21.95 29.325000000000003 28.275 20.45 28 21.175 30.125 28.075 20.625 29 21.75 27.525 28.299999999999997 22.425 30 21.0 28.9 28.7 21.4 31 20.8 29.225 27.474999999999998 22.5 32 21.725 28.375 28.775000000000002 21.125 33 20.875 28.875 28.625 21.625 34 21.85 28.15 28.799999999999997 21.2 35 21.975 28.825 26.674999999999997 22.525000000000002 36 21.425 30.375000000000004 26.974999999999998 21.224999999999998 37 21.6 28.725 27.900000000000002 21.775 38 20.8 30.75 27.725 20.724999999999998 39 21.675 28.449999999999996 28.225 21.65 40 19.775000000000002 30.325000000000003 27.625 22.275 41 21.925 29.025000000000002 27.700000000000003 21.349999999999998 42 21.95 27.625 29.125 21.3 43 21.725 28.625 27.825 21.825 44 20.4 28.999999999999996 28.1 22.5 45 19.900000000000002 29.299999999999997 28.799999999999997 22.0 46 20.974999999999998 28.95 29.049999999999997 21.025 47 22.3 29.15 27.250000000000004 21.3 48 21.7 28.299999999999997 27.700000000000003 22.3 49 21.55 29.825000000000003 27.35 21.275 50 22.725 28.799999999999997 27.500000000000004 20.974999999999998 51 22.0 28.875 27.250000000000004 21.875 52 21.6 28.925 27.35 22.125 53 22.275 28.7 27.900000000000002 21.125 54 21.2 28.675 28.575 21.55 55 20.4 28.999999999999996 29.275000000000002 21.325 56 22.35 28.725 28.199999999999996 20.724999999999998 57 20.925 30.049999999999997 27.725 21.3 58 22.0 28.1 28.199999999999996 21.7 59 22.125 28.425 28.375 21.075 60 20.849999999999998 28.799999999999997 29.15 21.2 61 21.25 29.099999999999998 27.175 22.475 62 21.25 29.175 27.900000000000002 21.675 63 22.075 28.65 27.425 21.85 64 20.674999999999997 28.275 28.299999999999997 22.75 65 21.55 29.875 28.025 20.549999999999997 66 21.125 28.775000000000002 27.575 22.525000000000002 67 21.3 28.549999999999997 28.349999999999998 21.8 68 21.3 29.45 28.175 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 1.5 19 3.0 20 3.0 21 4.0 22 5.0 23 8.5 24 14.0 25 16.0 26 21.0 27 28.5 28 31.0 29 44.5 30 64.0 31 70.0 32 85.0 33 117.5 34 135.0 35 149.5 36 197.5 37 231.0 38 235.5 39 259.5 40 293.5 41 308.0 42 329.5 43 351.0 44 351.0 45 335.0 46 309.0 47 299.0 48 271.5 49 219.5 50 195.0 51 175.5 52 137.5 53 119.0 54 104.0 55 78.5 56 68.0 57 55.0 58 32.5 59 23.0 60 16.5 61 14.0 62 18.0 63 12.5 64 7.0 65 6.0 66 5.0 67 4.0 68 2.5 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 1.5 75 3.0 76 1.5 77 0.0 78 0.0 79 0.0 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.15 0.0 0.0 0.0 0.0 54 0.15 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263553 spots for SRR3207715.sra Written 263553 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra Read 263546 spots for SRR3207715.sra Written 263546 spots for SRR3207715.sra SRR ids: ['SRR3207715.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mrh5tbxn SRR3207715.sra spots: 5270927 blocks: [[1, 263546], [263547, 527092], [527093, 790638], [790639, 1054184], [1054185, 1317730], [1317731, 1581276], [1581277, 1844822], [1844823, 2108368], [2108369, 2371914], [2371915, 2635460], [2635461, 2899006], [2899007, 3162552], [3162553, 3426098], [3426099, 3689644], [3689645, 3953190], [3953191, 4216736], [4216737, 4480282], [4480283, 4743828], [4743829, 5007374], [5007375, 5270927]] SRR3207715 file size 1106503 SRR3207715 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207715 SRR3207715_1.fastq Input file: SRR3207715_1.fastq trimmed: SRR3207715-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:08:36 2025 >> started Mon Feb 10 16:08:38 2025 >> done (2.620s) 5270927 reads processed; of these: 13694 ( 0.26%) short reads filtered out after trimming by size control 14786 ( 0.28%) empty reads filtered out after trimming by size control 5242447 (99.46%) reads available; of these: 446622 ( 8.52%) trimmed reads available after processing 4795825 (91.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1600 0.03% 19 2208 0.04% 20 3607 0.07% 21 1076 0.02% 22 1680 0.03% 23 2395 0.05% 24 4157 0.08% 25 7046 0.13% 26 1938 0.04% 27 2554 0.05% 28 3132 0.06% 29 5461 0.10% 30 8142 0.16% 31 1990 0.04% 32 2585 0.05% 33 3412 0.07% 34 5097 0.10% 35 7686 0.15% 36 2003 0.04% 37 2669 0.05% 38 3558 0.07% 39 5458 0.10% 40 7998 0.15% 41 2130 0.04% 42 3015 0.06% 43 4509 0.09% 44 6886 0.13% 45 10914 0.21% 46 2593 0.05% 47 3827 0.07% 48 5939 0.11% 49 9591 0.18% 50 15520 0.30% 51 3932 0.08% 52 6029 0.12% 53 8855 0.17% 54 15296 0.29% 55 27580 0.53% 56 5676 0.11% 57 8324 0.16% 58 12864 0.25% 59 21685 0.41% 60 38772 0.74% 61 7911 0.15% 62 11411 0.22% 63 17685 0.34% 64 30805 0.59% 65 49518 0.94% 66 10765 0.21% 67 17138 0.33% 68 4795825 91.48% 5242447 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=27 prefix-density=0.04 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=190.93 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=20.2 sequence=TTCTTCTTCTTC Started job on | Feb 10 16:08:53 Started mapping on | Feb 10 16:08:54 Finished on | Feb 10 16:09:00 Mapping speed, Million of reads per hour | 3145.47 Number of input reads | 5242447 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4829691 Uniquely mapped reads % | 92.13% Average mapped length | 66.66 Number of splices: Total | 867314 Number of splices: Annotated (sjdb) | 851961 Number of splices: GT/AG | 853548 Number of splices: GC/AG | 11206 Number of splices: AT/AC | 1081 Number of splices: Non-canonical | 1479 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 175560 % of reads mapped to multiple loci | 3.35% Number of reads mapped to too many loci | 208956 % of reads mapped to too many loci | 3.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 237196 237196 237196 N_multimapping 175560 175560 175560 N_noFeature 274022 2516741 2556330 N_ambiguous 46439 7952 7899 UnstrandedReadsAssigned:4509230 PositiveStrandReadsAssigned:2304998 NegativeStrandReadsAssigned:2265462 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207715 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207715-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,242,447 reads, 4,774,143 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR3207715.ke.tsv 34699 SRR3207715.se.tsv 87100 total ==> SRR3207715.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 158.49 24.9144 Potri.005G024800.1.v4.1 1035 936 51 16.4369 Potri.004G059700.1.v4.1 961 862 10 3.49959 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 90.3765 9.5863 Potri.016G087400.1.v4.1 270 171 188 331.655 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17 3.0635 Potri.012G127500.1.v4.1 977 878 878 301.665 ==> SRR3207715.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 668 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 90 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207715 completed mapping pipeline successfully