Starting /dee2/code/volunteer_pipeline.sh SRR3207716 current disk space = 3058428125184 free memory = 1301470084 SRR3207716 SRAfilesize 3b2b68318be3be5c97646c7f63afe07a SRR3207716.sra SRR3207716.sra file validated SRR3207716 is single end SRR3207716 is conventional basespace SRR3207716 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207716_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.66325 38.0 36.0 39.0 32.0 40.0 2 36.365 38.0 36.0 39.0 31.0 40.0 3 36.10825 38.0 35.0 39.0 30.0 40.0 4 36.11875 38.0 35.0 39.0 30.0 40.0 5 36.19225 38.0 35.0 39.0 30.0 40.0 6 36.12475 38.0 35.0 39.0 30.0 40.0 7 36.4985 38.0 36.0 39.0 31.0 40.0 8 36.29025 38.0 35.0 39.0 30.0 40.0 9 36.1535 38.0 35.0 39.0 30.0 40.0 10 36.02925 38.0 35.0 39.0 29.0 40.0 11 36.256 38.0 35.0 39.0 30.0 40.0 12 36.1015 38.0 35.0 39.0 29.0 40.0 13 36.226 38.0 35.0 39.0 30.0 40.0 14 35.89975 38.0 35.0 39.0 29.0 40.0 15 35.87125 38.0 35.0 39.0 29.0 40.0 16 36.03675 38.0 35.0 39.0 30.0 40.0 17 36.0795 38.0 35.0 39.0 29.0 40.0 18 35.804 38.0 35.0 39.0 29.0 40.0 19 35.74525 38.0 35.0 39.0 29.0 40.0 20 35.8275 38.0 35.0 39.0 29.0 40.0 21 35.94975 38.0 35.0 39.0 30.0 40.0 22 35.89925 38.0 35.0 39.0 29.0 40.0 23 35.82175 38.0 35.0 39.0 30.0 40.0 24 35.7085 38.0 35.0 39.0 29.0 40.0 25 35.56125 38.0 34.0 39.0 29.0 40.0 26 35.379 38.0 35.0 39.0 29.0 40.0 27 35.299 38.0 35.0 39.0 28.0 40.0 28 34.93925 38.0 33.0 39.0 27.0 40.0 29 35.14625 38.0 33.0 39.0 28.0 40.0 30 34.876 38.0 33.0 39.0 27.0 40.0 31 34.85225 38.0 33.0 39.0 27.0 40.0 32 34.77475 38.0 33.0 39.0 27.0 40.0 33 34.07825 38.0 33.0 39.0 25.0 40.0 34 34.00225 37.0 33.0 39.0 25.0 40.0 35 33.82075 37.0 33.0 39.0 24.0 40.0 36 34.0525 38.0 33.0 39.0 24.0 40.0 37 33.92825 37.0 33.0 39.0 24.0 40.0 38 33.80275 37.0 33.0 39.0 25.0 40.0 39 33.737 37.0 33.0 39.0 24.0 40.0 40 33.333 36.0 32.0 39.0 23.0 40.0 41 33.756 37.0 33.0 39.0 24.0 40.0 42 33.59925 37.0 33.0 39.0 24.0 40.0 43 33.30675 36.0 32.0 39.0 23.0 40.0 44 33.09825 36.0 32.0 39.0 23.0 40.0 45 33.2435 36.0 32.0 39.0 23.0 40.0 46 33.05325 36.0 32.0 39.0 23.0 40.0 47 32.92875 36.0 32.0 39.0 23.0 40.0 48 32.73225 36.0 31.0 39.0 22.0 40.0 49 32.706 36.0 31.0 39.0 23.0 40.0 50 32.3725 36.0 31.0 38.0 21.0 40.0 51 32.20125 36.0 31.0 38.0 19.0 40.0 52 32.2395 36.0 31.0 38.0 20.0 40.0 53 31.646 35.0 30.0 38.0 17.0 39.0 54 31.2525 35.0 29.0 38.0 17.0 39.0 55 31.3505 35.0 30.0 38.0 17.0 39.0 56 30.96125 35.0 29.0 38.0 12.0 39.0 57 30.89675 35.0 29.0 38.0 11.0 39.0 58 30.4775 35.0 29.0 38.0 10.0 39.0 59 30.50125 35.0 29.0 38.0 7.0 39.0 60 30.12325 34.0 28.0 38.0 2.0 39.0 61 29.391 34.0 28.0 37.0 2.0 39.0 62 29.451 34.0 28.0 37.0 2.0 39.0 63 29.46 34.0 28.0 37.0 2.0 39.0 64 29.2225 34.0 27.0 38.0 2.0 39.0 65 28.784 33.0 27.0 37.0 2.0 39.0 66 28.4515 33.0 27.0 37.0 2.0 39.0 67 28.247 33.0 27.0 37.0 2.0 39.0 68 27.93725 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 0.0 4 0.0 5 1.0 6 2.0 7 3.0 8 7.0 9 10.0 10 11.0 11 10.0 12 16.0 13 22.0 14 20.0 15 21.0 16 13.0 17 10.0 18 13.0 19 25.0 20 28.0 21 28.0 22 27.0 23 35.0 24 50.0 25 56.0 26 54.0 27 86.0 28 100.0 29 97.0 30 114.0 31 119.0 32 172.0 33 206.0 34 274.0 35 334.0 36 483.0 37 583.0 38 625.0 39 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.47058823529412 15.542596348884382 15.542596348884382 42.44421906693712 2 19.55 26.700000000000003 36.75 17.0 3 21.45 30.4 25.45 22.7 4 24.375 33.050000000000004 21.625 20.95 5 23.599999999999998 36.7 21.875 17.825 6 16.950000000000003 38.775 25.525 18.75 7 16.375 17.599999999999998 44.7 21.325 8 18.825 22.15 30.349999999999998 28.675 9 20.549999999999997 23.425 31.674999999999997 24.349999999999998 10 19.275000000000002 39.275 24.625 16.825000000000003 11 24.925 28.875 21.625 24.575 12 20.175 25.1 30.5 24.224999999999998 13 18.9 28.025 31.374999999999996 21.7 14 21.7 26.775 30.075000000000003 21.45 15 20.849999999999998 28.599999999999998 27.725 22.825 16 21.15 28.975 27.775 22.1 17 21.85546386596649 27.45686421605401 28.68217054263566 22.005501375343837 18 20.525 30.775000000000002 27.925 20.775 19 21.3 28.625 27.650000000000002 22.425 20 21.6 29.375 27.525 21.5 21 21.325 27.825 28.925 21.925 22 21.55 29.325000000000003 27.200000000000003 21.925 23 21.625 29.7 27.725 20.95 24 20.775 28.925 29.549999999999997 20.75 25 21.175 27.500000000000004 29.049999999999997 22.275 26 21.775 29.225 27.1 21.9 27 21.475 30.5 27.675 20.349999999999998 28 21.875 27.975 28.625 21.525 29 19.925 30.075000000000003 27.900000000000002 22.1 30 19.975 30.85 27.975 21.2 31 21.2 30.0 28.775000000000002 20.025000000000002 32 22.275 28.525 28.549999999999997 20.65 33 20.25 30.875000000000004 27.500000000000004 21.375 34 20.4 29.299999999999997 29.125 21.175 35 22.575 28.4 27.0 22.025 36 21.05 29.75 27.750000000000004 21.45 37 22.625 28.775000000000002 27.650000000000002 20.95 38 22.400000000000002 28.725 27.1 21.775 39 21.530382595648913 29.9074768692173 27.25681420355089 21.305326331582897 40 21.73043260815204 29.257314328582147 26.9567391847962 22.05551387846962 41 20.9 30.65 27.55 20.9 42 22.3 29.5 26.450000000000003 21.75 43 21.15 29.125 28.349999999999998 21.375 44 22.3 29.099999999999998 28.275 20.325 45 21.3 27.925 29.175 21.6 46 21.85 29.15 28.575 20.424999999999997 47 21.099999999999998 29.799999999999997 28.000000000000004 21.099999999999998 48 21.425 29.5 28.725 20.349999999999998 49 21.15 29.375 27.975 21.5 50 21.65 28.799999999999997 27.6 21.95 51 21.45 29.875 27.825 20.849999999999998 52 21.425 29.475 27.750000000000004 21.349999999999998 53 21.425 28.375 27.975 22.225 54 20.7 29.825000000000003 26.900000000000002 22.575 55 22.025 29.375 27.325 21.275 56 21.575 29.049999999999997 27.224999999999998 22.15 57 21.775 29.099999999999998 27.224999999999998 21.9 58 22.525000000000002 28.199999999999996 28.549999999999997 20.724999999999998 59 22.3 28.575 27.55 21.575 60 20.974999999999998 28.375 29.275000000000002 21.375 61 21.525 27.950000000000003 28.275 22.25 62 21.275 29.799999999999997 27.125 21.8 63 22.900000000000002 29.025000000000002 28.249999999999996 19.825 64 22.375 27.275 27.775 22.575 65 21.525 28.075 28.549999999999997 21.85 66 22.375 29.4 27.150000000000002 21.075 67 20.200000000000003 29.25 29.075 21.475 68 22.375 29.049999999999997 27.750000000000004 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 1.5 18 3.0 19 3.0 20 3.0 21 3.5 22 4.0 23 10.0 24 17.0 25 18.0 26 16.0 27 20.5 28 27.0 29 38.5 30 57.0 31 64.0 32 77.0 33 113.0 34 136.0 35 149.0 36 198.0 37 234.0 38 244.0 39 276.0 40 319.0 41 340.0 42 327.0 43 341.0 44 368.0 45 345.5 46 315.5 47 308.0 48 269.0 49 211.5 50 193.0 51 183.5 52 142.0 53 110.0 54 97.0 55 73.0 56 62.0 57 47.0 58 28.5 59 25.0 60 20.0 61 12.5 62 10.0 63 10.5 64 8.5 65 4.5 66 3.0 67 3.0 68 3.0 69 3.0 70 2.0 71 2.0 72 3.0 73 2.5 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.025 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.025 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264296 spots for SRR3207716.sra Written 264296 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra Read 264292 spots for SRR3207716.sra Written 264292 spots for SRR3207716.sra SRR ids: ['SRR3207716.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8vcsff8u SRR3207716.sra spots: 5285844 blocks: [[1, 264292], [264293, 528584], [528585, 792876], [792877, 1057168], [1057169, 1321460], [1321461, 1585752], [1585753, 1850044], [1850045, 2114336], [2114337, 2378628], [2378629, 2642920], [2642921, 2907212], [2907213, 3171504], [3171505, 3435796], [3435797, 3700088], [3700089, 3964380], [3964381, 4228672], [4228673, 4492964], [4492965, 4757256], [4757257, 5021548], [5021549, 5285844]] SRR3207716 file size 1109640 SRR3207716 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207716 SRR3207716_1.fastq Input file: SRR3207716_1.fastq trimmed: SRR3207716-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:23:56 2025 >> started Mon Feb 10 16:23:59 2025 >> done (2.854s) 5285844 reads processed; of these: 12728 ( 0.24%) short reads filtered out after trimming by size control 4931 ( 0.09%) empty reads filtered out after trimming by size control 5268185 (99.67%) reads available; of these: 448992 ( 8.52%) trimmed reads available after processing 4819193 (91.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1395 0.03% 19 2132 0.04% 20 3422 0.06% 21 1108 0.02% 22 1543 0.03% 23 2340 0.04% 24 3934 0.07% 25 6958 0.13% 26 1874 0.04% 27 2494 0.05% 28 3165 0.06% 29 5279 0.10% 30 7912 0.15% 31 2005 0.04% 32 2714 0.05% 33 3333 0.06% 34 5193 0.10% 35 7474 0.14% 36 1979 0.04% 37 2525 0.05% 38 3633 0.07% 39 5362 0.10% 40 7810 0.15% 41 2020 0.04% 42 3026 0.06% 43 4418 0.08% 44 6963 0.13% 45 10836 0.21% 46 2636 0.05% 47 3930 0.07% 48 5729 0.11% 49 9343 0.18% 50 15665 0.30% 51 3917 0.07% 52 6106 0.12% 53 8947 0.17% 54 15093 0.29% 55 27488 0.52% 56 5703 0.11% 57 8330 0.16% 58 13027 0.25% 59 22202 0.42% 60 39581 0.75% 61 7968 0.15% 62 11621 0.22% 63 18051 0.34% 64 31386 0.60% 65 50427 0.96% 66 11106 0.21% 67 17889 0.34% 68 4819193 91.48% 5268185 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=133.38 fanout-score-rank=7 prefix-density=0.25 prefix-fanout=18.2 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=204.64 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.7 sequence=TTCTTCTTCTTC Started job on | Feb 10 16:24:18 Started mapping on | Feb 10 16:24:18 Finished on | Feb 10 16:24:24 Mapping speed, Million of reads per hour | 3160.91 Number of input reads | 5268185 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4962833 Uniquely mapped reads % | 94.20% Average mapped length | 66.65 Number of splices: Total | 911010 Number of splices: Annotated (sjdb) | 896214 Number of splices: GT/AG | 896920 Number of splices: GC/AG | 11503 Number of splices: AT/AC | 1093 Number of splices: Non-canonical | 1494 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182579 % of reads mapped to multiple loci | 3.47% Number of reads mapped to too many loci | 95049 % of reads mapped to too many loci | 1.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 122773 122773 122773 N_multimapping 182579 182579 182579 N_noFeature 265054 2580237 2618430 N_ambiguous 45083 8000 7923 UnstrandedReadsAssigned:4652696 PositiveStrandReadsAssigned:2374596 NegativeStrandReadsAssigned:2336480 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207716 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207716-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,268,185 reads, 4,822,910 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR3207716.ke.tsv 34699 SRR3207716.se.tsv 87100 total ==> SRR3207716.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 253 39.2831 Potri.005G024800.1.v4.1 1035 936 133 42.3386 Potri.004G059700.1.v4.1 961 862 12 4.14796 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 119.176 12.4859 Potri.016G087400.1.v4.1 270 171 183 318.871 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 34 6.05179 Potri.012G127500.1.v4.1 977 878 900 305.428 ==> SRR3207716.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 630 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207716 completed mapping pipeline successfully