Starting /dee2/code/volunteer_pipeline.sh SRR3207717 current disk space = 3058703155200 free memory = 1147248812 SRR3207717 SRAfilesize 386e879c6e434b1d142719f280a9a708 SRR3207717.sra SRR3207717.sra file validated SRR3207717 is single end SRR3207717 is conventional basespace SRR3207717 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207717_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.72325 38.0 36.0 40.0 33.0 40.0 2 36.395 38.0 35.0 39.0 31.0 40.0 3 36.12675 38.0 35.0 39.0 30.0 40.0 4 36.11175 38.0 35.0 39.0 30.0 40.0 5 36.21325 38.0 35.0 39.0 30.0 40.0 6 36.1795 38.0 35.0 39.0 30.0 40.0 7 36.515 38.0 36.0 39.0 31.0 40.0 8 36.40475 38.0 35.0 39.0 31.0 40.0 9 36.22875 38.0 35.0 39.0 30.0 40.0 10 36.08425 38.0 35.0 39.0 29.0 40.0 11 36.53025 38.0 35.0 39.0 31.0 40.0 12 36.271 38.0 35.0 39.0 30.0 40.0 13 36.40875 38.0 35.0 39.0 31.0 40.0 14 36.10075 38.0 35.0 39.0 30.0 40.0 15 36.11225 38.0 35.0 39.0 30.0 40.0 16 36.2335 38.0 35.0 39.0 30.0 40.0 17 36.1385 38.0 35.0 39.0 30.0 40.0 18 35.9735 38.0 35.0 39.0 29.0 40.0 19 35.853 38.0 35.0 39.0 29.0 40.0 20 35.80825 38.0 35.0 39.0 29.0 40.0 21 35.971 38.0 35.0 39.0 30.0 40.0 22 35.9055 38.0 35.0 39.0 29.0 40.0 23 35.87075 38.0 35.0 39.0 29.0 40.0 24 35.78875 38.0 35.0 39.0 29.0 40.0 25 35.627 38.0 35.0 39.0 29.0 40.0 26 35.50925 38.0 35.0 39.0 28.0 40.0 27 35.4645 38.0 35.0 39.0 29.0 40.0 28 35.1155 38.0 33.0 39.0 28.0 40.0 29 35.28075 38.0 34.0 39.0 28.0 40.0 30 34.9385 38.0 33.0 39.0 27.0 40.0 31 34.952 38.0 33.0 39.0 27.0 40.0 32 34.8065 38.0 33.0 39.0 27.0 40.0 33 34.338 37.0 33.0 39.0 26.0 40.0 34 34.20425 37.0 33.0 39.0 25.0 40.0 35 34.03725 37.0 33.0 39.0 25.0 40.0 36 34.16775 38.0 33.0 39.0 25.0 40.0 37 34.03075 38.0 33.0 39.0 25.0 40.0 38 33.8425 37.0 33.0 39.0 25.0 40.0 39 33.83175 37.0 33.0 39.0 25.0 40.0 40 33.3135 36.0 31.0 39.0 23.0 40.0 41 33.7865 37.0 33.0 39.0 24.0 40.0 42 33.49325 36.0 32.0 39.0 23.0 40.0 43 33.35975 36.0 32.0 39.0 23.0 40.0 44 33.15475 36.0 32.0 39.0 23.0 40.0 45 33.09425 36.0 32.0 39.0 23.0 40.0 46 32.98875 36.0 32.0 39.0 23.0 40.0 47 32.885 36.0 32.0 39.0 22.0 40.0 48 32.79775 36.0 31.0 39.0 23.0 40.0 49 32.844 36.0 31.0 39.0 23.0 40.0 50 32.29075 36.0 31.0 38.0 21.0 40.0 51 32.28075 36.0 31.0 38.0 19.0 40.0 52 32.32325 36.0 31.0 38.0 20.0 40.0 53 31.87 35.0 31.0 38.0 18.0 39.0 54 31.39525 35.0 30.0 38.0 18.0 39.0 55 31.54525 35.0 30.0 38.0 18.0 39.0 56 31.137 35.0 30.0 38.0 15.0 39.0 57 30.97725 35.0 29.0 38.0 14.0 39.0 58 30.6875 35.0 29.0 38.0 11.0 39.0 59 30.6835 35.0 29.0 38.0 10.0 39.0 60 30.23 34.0 28.0 38.0 2.0 39.0 61 29.537 34.0 28.0 38.0 2.0 39.0 62 29.63175 34.0 28.0 37.0 2.0 39.0 63 29.412 34.0 28.0 38.0 2.0 39.0 64 29.309 34.0 28.0 37.0 2.0 39.0 65 28.89675 33.0 27.0 37.0 2.0 39.0 66 28.39425 33.0 26.0 37.0 2.0 39.0 67 28.25325 33.0 27.0 37.0 2.0 39.0 68 27.78725 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 0.0 5 1.0 6 5.0 7 5.0 8 9.0 9 5.0 10 11.0 11 14.0 12 10.0 13 13.0 14 11.0 15 25.0 16 17.0 17 19.0 18 25.0 19 30.0 20 18.0 21 29.0 22 30.0 23 33.0 24 38.0 25 58.0 26 62.0 27 59.0 28 101.0 29 85.0 30 115.0 31 143.0 32 161.0 33 213.0 34 247.0 35 387.0 36 474.0 37 586.0 38 613.0 39 331.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.168567807351078 15.386565272496833 18.580481622306717 42.864385297845374 2 20.424999999999997 27.325 35.5 16.75 3 22.2 29.775000000000002 26.650000000000002 21.375 4 25.0 32.975 20.7 21.325 5 25.15 37.425000000000004 22.575 14.85 6 17.925 39.074999999999996 24.55 18.45 7 15.8 16.725 45.225 22.25 8 18.95 23.974999999999998 28.975 28.1 9 18.475 24.275 31.7 25.55 10 20.7 39.050000000000004 23.45 16.8 11 25.775 28.575 20.7 24.95 12 19.55 24.95 29.5 26.0 13 18.75 28.000000000000004 32.574999999999996 20.674999999999997 14 20.75 27.500000000000004 29.049999999999997 22.7 15 22.075 28.7 27.075 22.15 16 19.675 30.575000000000003 27.35 22.400000000000002 17 22.225 28.499999999999996 27.55 21.725 18 21.65 29.375 25.374999999999996 23.599999999999998 19 22.525000000000002 28.025 27.150000000000002 22.3 20 21.6 29.349999999999998 26.35 22.7 21 21.6 29.375 28.825 20.200000000000003 22 21.425 29.299999999999997 27.650000000000002 21.625 23 21.15 29.925 27.400000000000002 21.525 24 21.224999999999998 29.549999999999997 28.65 20.575 25 21.3 27.900000000000002 28.125 22.675 26 21.45 28.575 28.299999999999997 21.675 27 21.525 29.45 27.275 21.75 28 21.5 28.575 27.35 22.575 29 21.625 29.075 28.749999999999996 20.549999999999997 30 20.674999999999997 29.025000000000002 27.950000000000003 22.35 31 22.0 28.7 27.150000000000002 22.15 32 21.075 31.45 26.450000000000003 21.025 33 21.625 28.775000000000002 28.225 21.375 34 21.15 29.2 26.85 22.8 35 20.9 28.65 28.15 22.3 36 21.875 28.849999999999998 27.650000000000002 21.625 37 21.375 28.549999999999997 27.675 22.400000000000002 38 21.55 28.525 28.375 21.55 39 21.025 29.075 27.625 22.275 40 21.475 28.65 27.725 22.15 41 23.425 28.225 27.6 20.75 42 20.424999999999997 29.15 28.325 22.1 43 21.349999999999998 28.875 28.7 21.075 44 21.575 27.500000000000004 29.15 21.775 45 20.45 28.575 28.4 22.575 46 21.15 27.700000000000003 28.1 23.05 47 21.6 29.549999999999997 26.325 22.525000000000002 48 20.474999999999998 29.375 27.900000000000002 22.25 49 20.974999999999998 27.875 29.4 21.75 50 21.55 28.625 27.875 21.95 51 20.95 29.625 28.4 21.025 52 21.975 28.199999999999996 28.65 21.175 53 20.974999999999998 28.65 28.725 21.65 54 20.474999999999998 29.45 27.925 22.15 55 21.45 28.799999999999997 28.1 21.65 56 22.45 27.800000000000004 27.575 22.175 57 22.325 29.299999999999997 27.55 20.825 58 23.599999999999998 27.224999999999998 28.199999999999996 20.974999999999998 59 21.95 29.45 28.625 19.975 60 21.45 27.650000000000002 29.15 21.75 61 23.549999999999997 26.575 27.825 22.05 62 22.575 28.199999999999996 27.950000000000003 21.275 63 22.0 30.15 27.800000000000004 20.05 64 21.65 28.549999999999997 27.725 22.075 65 20.974999999999998 29.375 26.8 22.85 66 22.5 29.099999999999998 26.974999999999998 21.425 67 22.825 28.349999999999998 28.199999999999996 20.625 68 23.275000000000002 28.999999999999996 26.724999999999998 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 2.5 21 5.0 22 5.0 23 6.0 24 12.0 25 17.0 26 17.5 27 22.5 28 27.0 29 35.0 30 52.0 31 61.0 32 76.0 33 112.0 34 133.0 35 147.5 36 186.5 37 211.0 38 224.5 39 260.5 40 296.0 41 309.0 42 326.5 43 343.5 44 343.0 45 343.0 46 318.0 47 293.0 48 273.0 49 239.0 50 225.0 51 199.0 52 150.5 53 128.0 54 115.0 55 80.0 56 58.0 57 53.5 58 35.0 59 21.0 60 18.0 61 14.5 62 14.0 63 11.0 64 6.0 65 4.0 66 4.0 67 2.5 68 1.5 69 2.0 70 1.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 1.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328671 spots for SRR3207717.sra Written 328671 spots for SRR3207717.sra Read 328673 spots for SRR3207717.sra Written 328673 spots for SRR3207717.sra SRR ids: ['SRR3207717.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g39uehps SRR3207717.sra spots: 6573422 blocks: [[1, 328671], [328672, 657342], [657343, 986013], [986014, 1314684], [1314685, 1643355], [1643356, 1972026], [1972027, 2300697], [2300698, 2629368], [2629369, 2958039], [2958040, 3286710], [3286711, 3615381], [3615382, 3944052], [3944053, 4272723], [4272724, 4601394], [4601395, 4930065], [4930066, 5258736], [5258737, 5587407], [5587408, 5916078], [5916079, 6244749], [6244750, 6573422]] SRR3207717 file size 1380202 SRR3207717 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207717 SRR3207717_1.fastq Input file: SRR3207717_1.fastq trimmed: SRR3207717-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:02:19 2025 >> started Mon Feb 10 16:02:22 2025 >> done (3.228s) 6573422 reads processed; of these: 18267 ( 0.28%) short reads filtered out after trimming by size control 14015 ( 0.21%) empty reads filtered out after trimming by size control 6541140 (99.51%) reads available; of these: 575294 ( 8.80%) trimmed reads available after processing 5965846 (91.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1977 0.03% 19 2813 0.04% 20 4532 0.07% 21 1390 0.02% 22 2027 0.03% 23 3078 0.05% 24 5184 0.08% 25 8989 0.14% 26 2372 0.04% 27 3249 0.05% 28 3997 0.06% 29 6880 0.11% 30 10453 0.16% 31 2566 0.04% 32 3439 0.05% 33 4385 0.07% 34 6640 0.10% 35 9582 0.15% 36 2555 0.04% 37 3331 0.05% 38 4530 0.07% 39 6967 0.11% 40 10183 0.16% 41 2801 0.04% 42 3854 0.06% 43 5679 0.09% 44 9222 0.14% 45 14080 0.22% 46 3440 0.05% 47 5059 0.08% 48 7509 0.11% 49 12325 0.19% 50 20267 0.31% 51 5023 0.08% 52 7662 0.12% 53 11685 0.18% 54 19529 0.30% 55 35160 0.54% 56 7464 0.11% 57 10555 0.16% 58 16590 0.25% 59 28165 0.43% 60 49942 0.76% 61 10252 0.16% 62 14628 0.22% 63 22847 0.35% 64 40221 0.61% 65 64101 0.98% 66 14099 0.22% 67 22016 0.34% 68 5965846 91.20% 6541140 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=41 prefix-density=0.00 prefix-fanout=1.0 sequence=AGTATGGCCCGGGGGATCCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=166.68 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=19.5 sequence=TTCTTCTTCTTC Started job on | Feb 10 16:02:39 Started mapping on | Feb 10 16:02:39 Finished on | Feb 10 16:02:57 Mapping speed, Million of reads per hour | 1308.23 Number of input reads | 6541140 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6156077 Uniquely mapped reads % | 94.11% Average mapped length | 66.61 Number of splices: Total | 1112850 Number of splices: Annotated (sjdb) | 1094324 Number of splices: GT/AG | 1095321 Number of splices: GC/AG | 14227 Number of splices: AT/AC | 1464 Number of splices: Non-canonical | 1838 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226631 % of reads mapped to multiple loci | 3.46% Number of reads mapped to too many loci | 119300 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 158432 158432 158432 N_multimapping 226631 226631 226631 N_noFeature 303552 3185577 3235340 N_ambiguous 58146 9631 9882 UnstrandedReadsAssigned:5794379 PositiveStrandReadsAssigned:2960869 NegativeStrandReadsAssigned:2910855 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207717 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207717-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,541,140 reads, 6,008,065 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR3207717.ke.tsv 34699 SRR3207717.se.tsv 87100 total ==> SRR3207717.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 224 28.0019 Potri.005G024800.1.v4.1 1035 936 87 22.2976 Potri.004G059700.1.v4.1 961 862 12 3.33956 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 145.809 12.299 Potri.016G087400.1.v4.1 270 171 210 294.604 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 30 4.29913 Potri.012G127500.1.v4.1 977 878 1106 302.187 ==> SRR3207717.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 859 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207717 completed mapping pipeline successfully