Starting /dee2/code/volunteer_pipeline.sh SRR3207718 current disk space = 3058619650048 free memory = 1015355252 SRR3207718 SRAfilesize ecff13a74aeda260e4a8172761a7164b SRR3207718.sra SRR3207718.sra file validated SRR3207718 is single end SRR3207718 is conventional basespace SRR3207718 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207718_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.73075 38.0 36.0 40.0 33.0 40.0 2 36.48625 38.0 36.0 40.0 31.0 40.0 3 36.3075 38.0 35.0 39.0 30.0 40.0 4 36.30375 38.0 35.0 40.0 30.0 40.0 5 36.28575 38.0 35.0 39.0 30.0 40.0 6 36.2655 38.0 35.0 39.0 30.0 40.0 7 36.52675 38.0 36.0 40.0 31.0 40.0 8 36.35325 38.0 35.0 40.0 30.0 40.0 9 36.282 38.0 35.0 39.0 30.0 40.0 10 36.23325 38.0 35.0 39.0 30.0 40.0 11 36.3635 38.0 35.0 39.0 31.0 40.0 12 36.23075 38.0 35.0 39.0 30.0 40.0 13 36.27975 38.0 35.0 39.0 30.0 40.0 14 36.0115 38.0 35.0 39.0 29.0 40.0 15 36.1365 38.0 35.0 39.0 30.0 40.0 16 36.25375 38.0 35.0 39.0 30.0 40.0 17 36.17225 38.0 35.0 39.0 30.0 40.0 18 36.0435 38.0 35.0 39.0 30.0 40.0 19 35.97725 38.0 35.0 39.0 30.0 40.0 20 35.876 38.0 35.0 39.0 29.0 40.0 21 36.17475 38.0 35.0 39.0 30.0 40.0 22 36.14575 38.0 35.0 39.0 30.0 40.0 23 35.90825 38.0 35.0 39.0 29.0 40.0 24 35.879 38.0 35.0 39.0 29.0 40.0 25 35.8405 38.0 35.0 39.0 29.0 40.0 26 35.5915 38.0 35.0 39.0 29.0 40.0 27 35.63025 38.0 35.0 39.0 29.0 40.0 28 35.23775 38.0 33.0 39.0 28.0 40.0 29 35.44 38.0 35.0 39.0 29.0 40.0 30 35.03625 38.0 33.0 39.0 27.0 40.0 31 35.05725 38.0 34.0 39.0 28.0 40.0 32 34.84325 38.0 33.0 39.0 27.0 40.0 33 34.473 38.0 33.0 39.0 26.0 40.0 34 34.338 38.0 33.0 39.0 26.0 40.0 35 34.1595 37.0 33.0 39.0 25.0 40.0 36 34.3545 38.0 33.0 39.0 26.0 40.0 37 34.30925 37.0 33.0 39.0 27.0 40.0 38 34.08825 37.0 33.0 39.0 25.0 40.0 39 34.151 37.0 33.0 39.0 26.0 40.0 40 33.79675 37.0 33.0 39.0 25.0 40.0 41 34.0395 37.0 33.0 39.0 26.0 40.0 42 33.7835 37.0 33.0 39.0 25.0 40.0 43 33.64325 37.0 33.0 39.0 24.0 40.0 44 33.4235 36.0 32.0 39.0 23.0 40.0 45 33.5145 36.0 33.0 39.0 24.0 40.0 46 33.32375 36.0 32.0 39.0 23.0 40.0 47 33.09525 36.0 32.0 39.0 23.0 40.0 48 33.02575 36.0 32.0 39.0 23.0 40.0 49 32.91575 36.0 32.0 39.0 23.0 40.0 50 32.552 36.0 31.0 38.0 22.0 40.0 51 32.32575 36.0 31.0 39.0 19.0 40.0 52 32.41775 36.0 31.0 38.0 21.0 40.0 53 31.947 35.0 30.0 38.0 19.0 39.0 54 31.57575 35.0 30.0 38.0 18.0 39.0 55 31.57025 35.0 30.0 38.0 18.0 39.0 56 31.391 35.0 30.0 38.0 15.0 39.0 57 31.22475 35.0 30.0 38.0 15.0 39.0 58 30.7255 35.0 29.0 38.0 12.0 39.0 59 30.67425 35.0 29.0 38.0 10.0 39.0 60 30.3695 35.0 29.0 38.0 2.0 39.0 61 29.543 34.0 28.0 37.0 2.0 39.0 62 29.71825 34.0 28.0 38.0 2.0 39.0 63 29.815 34.0 29.0 37.0 2.0 39.0 64 29.63475 34.0 29.0 37.0 2.0 39.0 65 29.2465 34.0 28.0 37.0 2.0 39.0 66 28.492 33.0 27.0 37.0 2.0 39.0 67 28.3255 33.0 27.0 37.0 2.0 39.0 68 27.89125 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 0.0 4 0.0 5 2.0 6 4.0 7 5.0 8 1.0 9 7.0 10 4.0 11 14.0 12 6.0 13 17.0 14 18.0 15 13.0 16 14.0 17 16.0 18 20.0 19 20.0 20 29.0 21 27.0 22 27.0 23 34.0 24 44.0 25 48.0 26 60.0 27 73.0 28 82.0 29 108.0 30 112.0 31 126.0 32 203.0 33 204.0 34 236.0 35 378.0 36 450.0 37 609.0 38 666.0 39 302.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.418144956918397 15.610745058286874 16.168271667511405 42.802838317283324 2 18.6 26.625 37.8 16.975 3 22.325 29.599999999999998 26.900000000000002 21.175 4 24.55 34.65 21.15 19.650000000000002 5 23.474999999999998 37.525 23.225 15.775 6 16.975 38.6 25.474999999999998 18.95 7 15.075 16.475 47.075 21.375 8 19.075 22.675 31.974999999999998 26.275 9 19.175 21.525 33.6 25.7 10 21.625 39.0 22.95 16.425 11 24.7 29.025000000000002 21.55 24.725 12 21.775 23.599999999999998 29.625 25.0 13 18.925 27.750000000000004 31.95 21.375 14 20.65 28.799999999999997 30.925000000000004 19.625 15 20.9 27.55 29.299999999999997 22.25 16 21.25 28.625 27.05 23.075000000000003 17 21.224999999999998 29.049999999999997 28.199999999999996 21.525 18 21.3 29.099999999999998 27.400000000000002 22.2 19 20.8 28.625 28.975 21.6 20 22.175 27.775 28.575 21.475 21 22.15 29.025000000000002 27.375 21.45 22 21.2 29.75 27.250000000000004 21.8 23 22.025 29.65 27.575 20.75 24 22.075 28.9 27.800000000000004 21.224999999999998 25 20.230057514378593 29.68242060515129 26.93173293323331 23.15578894723681 26 20.525 30.349999999999998 28.675 20.45 27 21.825 29.2 27.650000000000002 21.325 28 21.5 28.775000000000002 29.075 20.65 29 21.65 29.375 26.950000000000003 22.025 30 21.975 28.799999999999997 27.975 21.25 31 21.45 28.625 27.950000000000003 21.975 32 20.849999999999998 28.9 28.749999999999996 21.5 33 22.025 28.575 27.775 21.625 34 20.225 29.2 26.674999999999997 23.9 35 21.0 30.325000000000003 26.950000000000003 21.725 36 21.15 30.425 27.0 21.425 37 21.0 29.025000000000002 27.650000000000002 22.325 38 20.775 29.925 27.975 21.325 39 21.4 29.275000000000002 27.900000000000002 21.425 40 20.974999999999998 28.9 28.999999999999996 21.125 41 21.55 29.099999999999998 27.425 21.925 42 22.2 28.325 28.199999999999996 21.275 43 21.95 28.449999999999996 27.250000000000004 22.35 44 21.9 28.725 28.7 20.674999999999997 45 21.6 27.800000000000004 28.299999999999997 22.3 46 21.725 29.75 27.025 21.5 47 22.3 29.875 27.250000000000004 20.575 48 21.05 28.65 28.599999999999998 21.7 49 20.7 28.225 29.099999999999998 21.975 50 22.55 27.900000000000002 28.775000000000002 20.775 51 21.25 28.95 27.575 22.225 52 21.475 29.599999999999998 27.925 21.0 53 21.75 28.375 29.075 20.8 54 20.974999999999998 29.099999999999998 28.7 21.224999999999998 55 21.525 28.65 28.050000000000004 21.775 56 20.925 28.449999999999996 29.25 21.375 57 21.075 28.449999999999996 29.275000000000002 21.2 58 21.6 28.625 28.849999999999998 20.925 59 22.900000000000002 28.499999999999996 26.724999999999998 21.875 60 22.25 29.025000000000002 27.525 21.2 61 21.3 28.050000000000004 28.549999999999997 22.1 62 22.75 28.7 28.000000000000004 20.549999999999997 63 21.025 30.275000000000002 27.125 21.575 64 21.15 28.65 27.3 22.900000000000002 65 22.1 29.525000000000002 27.525 20.849999999999998 66 21.825 28.725 28.525 20.925 67 20.825 29.675 28.799999999999997 20.7 68 21.325 29.275000000000002 28.775000000000002 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.5 18 2.0 19 2.0 20 1.5 21 3.0 22 5.0 23 7.0 24 11.5 25 14.0 26 18.5 27 28.0 28 33.0 29 42.0 30 56.5 31 62.0 32 83.5 33 106.5 34 108.0 35 142.0 36 195.5 37 215.0 38 228.5 39 267.0 40 327.5 41 363.0 42 362.0 43 374.5 44 388.0 45 357.5 46 300.5 47 274.0 48 249.0 49 222.5 50 221.0 51 187.0 52 128.0 53 103.0 54 92.5 55 69.5 56 57.0 57 45.5 58 25.5 59 17.0 60 14.0 61 9.5 62 8.0 63 10.0 64 8.5 65 5.5 66 6.0 67 4.5 68 3.5 69 4.0 70 2.5 71 1.5 72 2.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.025 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330932 spots for SRR3207718.sra Written 330932 spots for SRR3207718.sra Read 330947 spots for SRR3207718.sra Written 330947 spots for SRR3207718.sra SRR ids: ['SRR3207718.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mettjnzl SRR3207718.sra spots: 6618655 blocks: [[1, 330932], [330933, 661864], [661865, 992796], [992797, 1323728], [1323729, 1654660], [1654661, 1985592], [1985593, 2316524], [2316525, 2647456], [2647457, 2978388], [2978389, 3309320], [3309321, 3640252], [3640253, 3971184], [3971185, 4302116], [4302117, 4633048], [4633049, 4963980], [4963981, 5294912], [5294913, 5625844], [5625845, 5956776], [5956777, 6287708], [6287709, 6618655]] SRR3207718 file size 1389720 SRR3207718 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207718 SRR3207718_1.fastq Input file: SRR3207718_1.fastq trimmed: SRR3207718-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:12:08 2025 >> started Mon Feb 10 16:12:11 2025 >> done (3.376s) 6618655 reads processed; of these: 16750 ( 0.25%) short reads filtered out after trimming by size control 9548 ( 0.14%) empty reads filtered out after trimming by size control 6592357 (99.60%) reads available; of these: 555187 ( 8.42%) trimmed reads available after processing 6037170 (91.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1853 0.03% 19 2748 0.04% 20 4105 0.06% 21 1372 0.02% 22 2005 0.03% 23 3017 0.05% 24 5074 0.08% 25 8776 0.13% 26 2288 0.03% 27 3122 0.05% 28 3845 0.06% 29 6466 0.10% 30 9787 0.15% 31 2545 0.04% 32 3253 0.05% 33 4233 0.06% 34 6330 0.10% 35 9307 0.14% 36 2442 0.04% 37 3155 0.05% 38 4417 0.07% 39 6795 0.10% 40 9802 0.15% 41 2593 0.04% 42 3677 0.06% 43 5623 0.09% 44 8484 0.13% 45 13303 0.20% 46 3194 0.05% 47 4810 0.07% 48 7275 0.11% 49 11791 0.18% 50 19638 0.30% 51 4941 0.07% 52 7436 0.11% 53 10927 0.17% 54 18844 0.29% 55 34314 0.52% 56 7158 0.11% 57 10284 0.16% 58 16026 0.24% 59 27159 0.41% 60 48746 0.74% 61 9896 0.15% 62 13843 0.21% 63 22091 0.34% 64 38943 0.59% 65 62400 0.95% 66 13512 0.20% 67 21542 0.33% 68 6037170 91.58% 6592357 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=122.68 fanout-score-rank=5 prefix-density=0.23 prefix-fanout=17.6 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=217.41 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=22.2 sequence=TTCTTCTTCTTC Started job on | Feb 10 16:12:26 Started mapping on | Feb 10 16:12:26 Finished on | Feb 10 16:12:33 Mapping speed, Million of reads per hour | 3390.36 Number of input reads | 6592357 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6243003 Uniquely mapped reads % | 94.70% Average mapped length | 66.66 Number of splices: Total | 1133463 Number of splices: Annotated (sjdb) | 1114245 Number of splices: GT/AG | 1115618 Number of splices: GC/AG | 14634 Number of splices: AT/AC | 1353 Number of splices: Non-canonical | 1858 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218388 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 97408 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 130966 130966 130966 N_multimapping 218388 218388 218388 N_noFeature 336787 3243142 3297363 N_ambiguous 59540 10172 10148 UnstrandedReadsAssigned:5846676 PositiveStrandReadsAssigned:2989689 NegativeStrandReadsAssigned:2935492 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207718 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207718-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,592,357 reads, 6,036,738 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR3207718.ke.tsv 34699 SRR3207718.se.tsv 87100 total ==> SRR3207718.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 197.524 25.1229 Potri.005G024800.1.v4.1 1035 936 73.0163 19.0401 Potri.004G059700.1.v4.1 961 862 7 1.98205 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 122.103 10.479 Potri.016G087400.1.v4.1 270 171 229 326.862 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 29 4.22832 Potri.012G127500.1.v4.1 977 878 1303 362.222 ==> SRR3207718.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 914 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 101 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207718 completed mapping pipeline successfully