Starting /dee2/code/volunteer_pipeline.sh SRR3207719 current disk space = 3058659377152 free memory = 1161075056 SRR3207719 SRAfilesize d56513988b0f047d464fbe70468bd068 SRR3207719.sra SRR3207719.sra file validated SRR3207719 is single end SRR3207719 is conventional basespace SRR3207719 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207719_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.53725 39.0 38.0 40.0 33.0 40.0 2 37.31075 39.0 37.0 40.0 33.0 40.0 3 37.13975 39.0 36.0 40.0 33.0 40.0 4 37.13825 39.0 36.0 40.0 33.0 40.0 5 37.07975 39.0 36.0 40.0 33.0 40.0 6 37.372 39.0 37.0 40.0 33.0 40.0 7 37.292 39.0 37.0 40.0 33.0 40.0 8 37.01825 39.0 36.0 40.0 33.0 40.0 9 37.1495 39.0 36.0 40.0 33.0 40.0 10 36.9735 39.0 36.0 40.0 32.0 40.0 11 36.8865 39.0 36.0 40.0 32.0 40.0 12 36.78 39.0 36.0 40.0 31.0 40.0 13 36.81025 39.0 36.0 40.0 31.0 40.0 14 36.75375 38.0 35.0 40.0 31.0 40.0 15 36.78725 38.0 36.0 40.0 31.0 40.0 16 36.79675 39.0 36.0 40.0 31.0 40.0 17 36.55075 38.0 35.0 40.0 31.0 40.0 18 36.64925 38.0 36.0 40.0 31.0 40.0 19 36.44275 38.0 35.0 40.0 30.0 40.0 20 36.483 38.0 35.0 40.0 31.0 40.0 21 36.44925 38.0 35.0 40.0 31.0 40.0 22 36.1655 38.0 35.0 40.0 30.0 40.0 23 36.1325 38.0 35.0 40.0 30.0 40.0 24 36.2625 38.0 35.0 40.0 30.0 40.0 25 36.21075 38.0 35.0 40.0 30.0 40.0 26 36.101 38.0 35.0 39.0 30.0 40.0 27 35.84425 38.0 35.0 39.0 29.0 40.0 28 35.57925 38.0 35.0 39.0 29.0 40.0 29 35.63975 38.0 35.0 39.0 29.0 40.0 30 35.68575 38.0 35.0 39.0 29.0 40.0 31 35.39225 38.0 35.0 39.0 29.0 40.0 32 34.9605 38.0 33.0 39.0 27.0 40.0 33 34.905 38.0 33.0 39.0 27.0 40.0 34 34.82625 38.0 33.0 39.0 27.0 40.0 35 34.928 38.0 34.0 39.0 28.0 40.0 36 34.6035 38.0 33.0 39.0 27.0 40.0 37 33.91275 37.0 33.0 39.0 24.0 40.0 38 34.19475 37.0 33.0 39.0 26.0 40.0 39 34.187 37.0 33.0 39.0 27.0 40.0 40 33.69975 36.0 33.0 39.0 24.0 40.0 41 33.88275 37.0 33.0 39.0 25.0 40.0 42 33.54025 36.0 33.0 39.0 23.0 40.0 43 33.54825 36.0 33.0 39.0 24.0 40.0 44 33.07625 36.0 32.0 39.0 23.0 40.0 45 33.2495 36.0 32.0 39.0 23.0 40.0 46 33.51225 36.0 33.0 39.0 25.0 40.0 47 33.1185 36.0 32.0 39.0 23.0 40.0 48 33.0385 36.0 32.0 39.0 23.0 40.0 49 32.948 36.0 32.0 39.0 23.0 40.0 50 32.81025 36.0 32.0 38.0 23.0 40.0 51 32.51825 36.0 32.0 38.0 21.0 40.0 52 32.27425 35.0 31.0 38.0 21.0 39.0 53 32.0815 35.0 31.0 38.0 19.0 39.0 54 31.4595 35.0 30.0 38.0 18.0 39.0 55 31.49 35.0 30.0 38.0 18.0 39.0 56 31.098 35.0 30.0 38.0 15.0 39.0 57 30.395 34.0 29.0 37.0 10.0 39.0 58 30.43125 34.0 29.0 37.0 8.0 39.0 59 30.2095 34.0 29.0 37.0 2.0 39.0 60 29.7485 34.0 29.0 37.0 2.0 39.0 61 29.568 34.0 29.0 37.0 2.0 39.0 62 29.3575 33.0 28.0 37.0 2.0 39.0 63 29.02875 33.0 28.0 36.0 2.0 39.0 64 28.83275 33.0 27.0 36.0 2.0 39.0 65 28.679 33.0 27.0 36.0 2.0 39.0 66 28.4835 33.0 27.0 36.0 2.0 39.0 67 27.89025 33.0 26.0 36.0 2.0 39.0 68 27.8705 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 2.0 6 1.0 7 1.0 8 4.0 9 12.0 10 12.0 11 12.0 12 14.0 13 18.0 14 26.0 15 11.0 16 17.0 17 11.0 18 16.0 19 21.0 20 30.0 21 29.0 22 28.0 23 30.0 24 35.0 25 46.0 26 71.0 27 54.0 28 65.0 29 74.0 30 84.0 31 130.0 32 164.0 33 211.0 34 294.0 35 376.0 36 501.0 37 597.0 38 727.0 39 268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.025125628140703 15.42713567839196 14.924623115577889 44.62311557788945 2 18.675 25.25 37.425000000000004 18.65 3 21.625 28.849999999999998 26.400000000000002 23.125 4 23.599999999999998 34.55 20.075000000000003 21.775 5 24.7 35.8 22.1 17.4 6 18.099999999999998 38.175 24.3 19.425 7 15.675 16.925 46.075 21.325 8 17.724999999999998 23.474999999999998 32.225 26.575 9 19.400000000000002 22.475 33.125 25.0 10 20.200000000000003 40.1 23.425 16.275000000000002 11 23.275000000000002 30.025000000000002 20.45 26.25 12 20.375 27.200000000000003 27.725 24.7 13 19.475 28.075 31.15 21.3 14 20.724999999999998 29.475 28.749999999999996 21.05 15 21.05 27.05 28.000000000000004 23.9 16 21.575 27.85 27.800000000000004 22.775000000000002 17 22.725 27.450000000000003 27.950000000000003 21.875 18 21.224999999999998 29.075 27.700000000000003 22.0 19 21.224999999999998 29.349999999999998 26.924999999999997 22.5 20 22.25 28.225 27.05 22.475 21 21.925 28.000000000000004 28.325 21.75 22 21.0 29.575000000000003 27.975 21.45 23 20.974999999999998 29.15 27.275 22.6 24 20.974999999999998 28.525 28.449999999999996 22.05 25 20.9 28.325 28.375 22.400000000000002 26 21.975 28.050000000000004 28.799999999999997 21.175 27 20.825 27.750000000000004 29.95 21.475 28 20.075000000000003 27.875 28.775000000000002 23.275000000000002 29 21.575 28.725 27.800000000000004 21.9 30 21.6 29.375 27.275 21.75 31 19.900000000000002 28.775000000000002 28.175 23.150000000000002 32 22.25 28.999999999999996 26.575 22.175 33 21.6 27.725 28.299999999999997 22.375 34 20.849999999999998 28.225 27.55 23.375 35 22.75 27.950000000000003 27.525 21.775 36 21.7 28.9 26.6 22.8 37 20.775 28.075 28.95 22.2 38 22.775000000000002 28.075 27.85 21.3 39 20.75 27.625 28.499999999999996 23.125 40 21.65 28.15 27.650000000000002 22.55 41 20.1 30.075000000000003 28.075 21.75 42 21.425 28.749999999999996 27.224999999999998 22.6 43 21.575 29.025000000000002 28.125 21.275 44 22.3 30.2 26.775 20.724999999999998 45 22.425 27.275 28.599999999999998 21.7 46 20.65 28.175 27.500000000000004 23.674999999999997 47 22.125 28.825 28.775000000000002 20.275000000000002 48 23.05 26.474999999999998 29.2 21.275 49 20.5 28.249999999999996 29.549999999999997 21.7 50 21.575 28.875 27.3 22.25 51 22.175 28.249999999999996 26.775 22.8 52 22.0 29.175 27.400000000000002 21.425 53 22.18054513628407 30.257564391097773 27.481870467616904 20.080020005001252 54 22.725 28.4 25.85 23.025000000000002 55 22.025 27.700000000000003 28.499999999999996 21.775 56 21.0 29.975 26.900000000000002 22.125 57 22.625 27.700000000000003 27.400000000000002 22.275 58 20.375 29.299999999999997 29.625 20.7 59 21.85 29.575000000000003 28.275 20.3 60 22.025 28.599999999999998 27.325 22.05 61 22.775000000000002 28.000000000000004 28.050000000000004 21.175 62 22.2 28.9 27.825 21.075 63 21.3 29.825000000000003 27.6 21.275 64 22.0 27.975 27.075 22.95 65 21.275 28.275 29.175 21.275 66 22.8 28.325 27.55 21.325 67 21.5 29.875 26.775 21.85 68 22.225 29.475 27.450000000000003 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 2.0 16 1.0 17 0.5 18 2.0 19 4.0 20 2.0 21 3.5 22 7.0 23 7.5 24 8.5 25 9.0 26 13.5 27 24.0 28 30.0 29 35.0 30 55.0 31 70.0 32 76.0 33 99.0 34 116.0 35 130.5 36 183.5 37 222.0 38 232.0 39 259.5 40 303.0 41 329.0 42 340.0 43 341.5 44 332.0 45 333.0 46 317.5 47 301.0 48 284.0 49 246.5 50 226.0 51 192.0 52 140.5 53 123.0 54 104.5 55 73.0 56 60.0 57 53.5 58 40.5 59 34.0 60 27.0 61 16.5 62 13.0 63 12.0 64 7.0 65 2.5 66 2.0 67 4.0 68 5.0 69 4.0 70 2.5 71 3.0 72 5.0 73 4.0 74 4.0 75 5.0 76 2.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.025 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297391 spots for SRR3207719.sra Written 297391 spots for SRR3207719.sra Read 297408 spots for SRR3207719.sra Written 297408 spots for SRR3207719.sra SRR ids: ['SRR3207719.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_enpm51je SRR3207719.sra spots: 5947837 blocks: [[1, 297391], [297392, 594782], [594783, 892173], [892174, 1189564], [1189565, 1486955], [1486956, 1784346], [1784347, 2081737], [2081738, 2379128], [2379129, 2676519], [2676520, 2973910], [2973911, 3271301], [3271302, 3568692], [3568693, 3866083], [3866084, 4163474], [4163475, 4460865], [4460866, 4758256], [4758257, 5055647], [5055648, 5353038], [5353039, 5650429], [5650430, 5947837]] SRR3207719 file size 1248753 SRR3207719 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207719 SRR3207719_1.fastq Input file: SRR3207719_1.fastq trimmed: SRR3207719-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:07:36 2025 >> started Mon Feb 10 16:07:39 2025 >> done (2.849s) 5947837 reads processed; of these: 18513 ( 0.31%) short reads filtered out after trimming by size control 21025 ( 0.35%) empty reads filtered out after trimming by size control 5908299 (99.34%) reads available; of these: 493270 ( 8.35%) trimmed reads available after processing 5415029 (91.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2115 0.04% 19 3364 0.06% 20 5498 0.09% 21 1615 0.03% 22 2264 0.04% 23 3571 0.06% 24 5910 0.10% 25 9530 0.16% 26 2548 0.04% 27 3244 0.05% 28 4327 0.07% 29 6493 0.11% 30 10238 0.17% 31 2579 0.04% 32 3178 0.05% 33 4227 0.07% 34 6322 0.11% 35 9253 0.16% 36 2345 0.04% 37 3019 0.05% 38 4200 0.07% 39 6429 0.11% 40 9744 0.16% 41 2280 0.04% 42 3372 0.06% 43 5355 0.09% 44 8204 0.14% 45 12396 0.21% 46 2867 0.05% 47 3906 0.07% 48 6195 0.10% 49 10895 0.18% 50 17472 0.30% 51 4206 0.07% 52 6376 0.11% 53 9927 0.17% 54 16195 0.27% 55 29291 0.50% 56 5946 0.10% 57 8629 0.15% 58 13151 0.22% 59 22592 0.38% 60 40292 0.68% 61 8191 0.14% 62 11414 0.19% 63 18252 0.31% 64 31005 0.52% 65 52913 0.90% 66 11349 0.19% 67 18586 0.31% 68 5415029 91.65% 5908299 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.05 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=15 fanout-score=172.34 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=19.4 sequence=TTCTTCTTCTTC Started job on | Feb 10 16:07:55 Started mapping on | Feb 10 16:07:55 Finished on | Feb 10 16:08:01 Mapping speed, Million of reads per hour | 3544.98 Number of input reads | 5908299 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5426851 Uniquely mapped reads % | 91.85% Average mapped length | 66.65 Number of splices: Total | 986480 Number of splices: Annotated (sjdb) | 969647 Number of splices: GT/AG | 971008 Number of splices: GC/AG | 12780 Number of splices: AT/AC | 1259 Number of splices: Non-canonical | 1433 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 189275 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 267668 % of reads mapped to too many loci | 4.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 292173 292173 292173 N_multimapping 189275 189275 189275 N_noFeature 288655 2821919 2856272 N_ambiguous 54530 8564 8709 UnstrandedReadsAssigned:5083666 PositiveStrandReadsAssigned:2596368 NegativeStrandReadsAssigned:2561870 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207719 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207719-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,908,299 reads, 5,397,806 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR3207719.ke.tsv 34699 SRR3207719.se.tsv 87100 total ==> SRR3207719.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 168 23.3134 Potri.005G024800.1.v4.1 1035 936 52 14.7944 Potri.004G059700.1.v4.1 961 862 18 5.56079 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 97.3253 9.11312 Potri.016G087400.1.v4.1 270 171 177 275.644 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27 4.29516 Potri.012G127500.1.v4.1 977 878 917 278.129 ==> SRR3207719.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 758 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 83 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207719 completed mapping pipeline successfully