Starting /dee2/code/volunteer_pipeline.sh SRR3207720 current disk space = 3058443157504 free memory = 1013973228 SRR3207720 SRAfilesize 90e4068bbf2a7264e6c8e7fa22dfdaa5 SRR3207720.sra SRR3207720.sra file validated SRR3207720 is single end SRR3207720 is conventional basespace SRR3207720 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207720_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.5415 39.0 38.0 40.0 33.0 40.0 2 37.1755 39.0 37.0 40.0 33.0 40.0 3 37.04825 39.0 36.0 40.0 33.0 40.0 4 36.945 39.0 36.0 40.0 32.0 40.0 5 37.0215 39.0 36.0 40.0 33.0 40.0 6 37.1105 39.0 36.0 40.0 33.0 40.0 7 37.1605 39.0 36.0 40.0 33.0 40.0 8 36.8735 39.0 36.0 40.0 31.0 40.0 9 36.99575 39.0 36.0 40.0 32.0 40.0 10 36.911 39.0 36.0 40.0 32.0 40.0 11 36.76125 39.0 36.0 40.0 31.0 40.0 12 36.74225 39.0 36.0 40.0 31.0 40.0 13 36.74475 38.0 36.0 40.0 31.0 40.0 14 36.6975 38.0 36.0 40.0 31.0 40.0 15 36.662 38.0 35.0 40.0 31.0 40.0 16 36.6555 39.0 36.0 40.0 31.0 40.0 17 36.49575 38.0 35.0 40.0 31.0 40.0 18 36.63875 38.0 35.0 40.0 31.0 40.0 19 36.3925 38.0 35.0 40.0 30.0 40.0 20 36.52875 38.0 35.0 40.0 31.0 40.0 21 36.483 38.0 35.0 40.0 31.0 40.0 22 36.119 38.0 35.0 40.0 30.0 40.0 23 36.1985 38.0 35.0 40.0 31.0 40.0 24 36.24925 38.0 35.0 40.0 30.0 40.0 25 36.21025 38.0 35.0 40.0 30.0 40.0 26 36.08875 38.0 35.0 39.0 30.0 40.0 27 35.7205 38.0 35.0 39.0 29.0 40.0 28 35.5465 38.0 35.0 39.0 29.0 40.0 29 35.64325 38.0 35.0 39.0 29.0 40.0 30 35.56175 38.0 35.0 39.0 29.0 40.0 31 35.21375 38.0 35.0 39.0 28.0 40.0 32 34.99525 38.0 33.0 39.0 27.0 40.0 33 34.7745 38.0 33.0 39.0 27.0 40.0 34 34.61125 38.0 33.0 39.0 27.0 40.0 35 34.788 38.0 33.0 39.0 27.0 40.0 36 34.48275 38.0 33.0 39.0 26.0 40.0 37 33.84275 37.0 33.0 39.0 25.0 40.0 38 34.09025 37.0 33.0 39.0 25.0 40.0 39 34.0565 37.0 33.0 39.0 25.0 40.0 40 33.671 37.0 32.0 39.0 23.0 40.0 41 33.70675 36.0 33.0 39.0 24.0 40.0 42 33.64 36.0 33.0 39.0 24.0 40.0 43 33.714 36.0 33.0 39.0 25.0 40.0 44 33.084 36.0 31.0 39.0 23.0 40.0 45 33.1465 36.0 31.0 39.0 23.0 40.0 46 33.452 36.0 33.0 39.0 24.0 40.0 47 33.1965 36.0 32.0 39.0 23.0 40.0 48 33.163 36.0 32.0 39.0 24.0 40.0 49 32.88875 36.0 31.0 38.0 23.0 40.0 50 32.6535 36.0 31.0 39.0 23.0 40.0 51 32.57725 36.0 32.0 39.0 22.0 40.0 52 32.14325 35.0 31.0 38.0 20.0 39.0 53 32.1425 35.0 31.0 38.0 21.0 39.0 54 31.467 35.0 30.0 38.0 18.0 39.0 55 31.46275 35.0 30.0 38.0 17.0 39.0 56 30.957 35.0 29.0 38.0 10.0 39.0 57 30.47675 34.0 29.0 38.0 10.0 39.0 58 30.4135 34.0 29.0 37.0 9.0 39.0 59 30.22075 34.0 29.0 37.0 2.0 39.0 60 29.851 34.0 29.0 37.0 2.0 39.0 61 29.555 34.0 29.0 37.0 2.0 39.0 62 29.4185 34.0 28.0 37.0 2.0 39.0 63 28.931 33.0 27.0 36.0 2.0 39.0 64 28.97675 33.0 27.0 36.0 2.0 39.0 65 28.775 33.0 27.0 36.0 2.0 39.0 66 28.37975 33.0 27.0 36.0 2.0 39.0 67 27.72925 33.0 26.0 36.0 2.0 38.0 68 27.716 33.0 26.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 3.0 6 4.0 7 3.0 8 3.0 9 6.0 10 14.0 11 14.0 12 9.0 13 17.0 14 19.0 15 11.0 16 11.0 17 15.0 18 23.0 19 13.0 20 22.0 21 23.0 22 30.0 23 33.0 24 35.0 25 65.0 26 71.0 27 64.0 28 78.0 29 89.0 30 103.0 31 131.0 32 152.0 33 200.0 34 282.0 35 339.0 36 506.0 37 644.0 38 691.0 39 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.886763965777554 14.091595369904377 17.689984901862104 43.33165576245596 2 19.625 23.9 37.525 18.95 3 22.875 26.150000000000002 28.175 22.8 4 25.575 32.85 20.8 20.775 5 25.85 35.025 22.575 16.55 6 19.125 38.224999999999994 23.799999999999997 18.85 7 16.05 18.725 44.725 20.5 8 18.85 22.1 30.275000000000002 28.775000000000002 9 19.975 23.150000000000002 31.825 25.05 10 18.85 37.7 24.45 19.0 11 24.675 28.875 22.375 24.075 12 20.349999999999998 25.525 29.65 24.474999999999998 13 18.099999999999998 28.65 31.924999999999997 21.325 14 20.375 27.525 29.375 22.725 15 20.875 29.075 27.375 22.675 16 20.325 29.575000000000003 27.925 22.175 17 21.25 28.075 27.900000000000002 22.775000000000002 18 20.45 27.325 29.025000000000002 23.200000000000003 19 21.725 28.725 27.450000000000003 22.1 20 22.900000000000002 28.175 27.250000000000004 21.675 21 22.0 30.2 25.95 21.85 22 21.8 29.349999999999998 27.650000000000002 21.2 23 21.4 29.825000000000003 28.175 20.599999999999998 24 21.75 29.025000000000002 27.375 21.85 25 21.425 29.825000000000003 26.85 21.9 26 22.475 29.425 26.900000000000002 21.2 27 22.05551387846962 28.532133033258315 26.406601650412604 23.005751437859466 28 21.305326331582897 28.00700175043761 28.00700175043761 22.680670167541887 29 21.975 29.375 27.200000000000003 21.45 30 22.355588897224308 27.981995498874717 27.406851712928233 22.255563890972745 31 22.43060765191298 28.907226806701676 28.032008002000502 20.630157539384847 32 22.6 29.45 26.575 21.375 33 21.9 28.249999999999996 28.249999999999996 21.6 34 21.7 28.775000000000002 27.474999999999998 22.05 35 22.0 28.725 26.825 22.45 36 21.45 29.45 27.224999999999998 21.875 37 21.45 29.175 27.474999999999998 21.9 38 20.825 29.25 27.575 22.35 39 21.405351337834457 28.00700175043761 28.582145536384097 22.005501375343837 40 22.400000000000002 27.200000000000003 28.175 22.225 41 21.55 29.7 27.450000000000003 21.3 42 21.65 27.375 28.475 22.5 43 22.330582645661416 27.956989247311824 27.68192048012003 22.030507626906726 44 23.175 27.975 27.85 21.0 45 21.65 27.700000000000003 28.925 21.725 46 21.875 27.900000000000002 28.449999999999996 21.775 47 22.175 29.099999999999998 27.425 21.3 48 21.655413853463365 28.557139284821204 28.632158039509875 21.155288822205552 49 21.45 30.2 26.674999999999997 21.675 50 21.2 30.0 26.775 22.025 51 21.6 28.799999999999997 28.1 21.5 52 22.18054513628407 27.656914228557138 28.28207051762941 21.880470117529384 53 22.9057264316079 28.28207051762941 28.107026756689173 20.705176294073517 54 22.2 27.675 28.050000000000004 22.075 55 22.225 28.425 28.199999999999996 21.15 56 21.325 28.775000000000002 28.125 21.775 57 21.425 28.125 28.075 22.375 58 21.85 28.175 27.55 22.425 59 20.974999999999998 28.95 28.325 21.75 60 21.425 28.499999999999996 27.800000000000004 22.275 61 20.125 29.575000000000003 28.575 21.725 62 22.725 26.85 28.549999999999997 21.875 63 20.8 28.999999999999996 28.875 21.325 64 21.625 29.099999999999998 27.375 21.9 65 21.3 28.799999999999997 27.175 22.725 66 21.675 29.075 26.825 22.425 67 20.849999999999998 29.275000000000002 27.150000000000002 22.725 68 21.15 29.575000000000003 27.750000000000004 21.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.5 22 4.0 23 5.5 24 8.0 25 9.0 26 16.5 27 26.0 28 28.0 29 33.5 30 45.5 31 52.0 32 64.0 33 85.0 34 94.0 35 119.5 36 169.0 37 193.0 38 225.5 39 291.5 40 327.0 41 329.0 42 342.5 43 353.0 44 350.0 45 328.5 46 311.5 47 316.0 48 301.0 49 255.0 50 224.0 51 196.0 52 142.5 53 117.0 54 103.5 55 72.5 56 55.0 57 45.5 58 33.5 59 31.0 60 25.0 61 18.5 62 18.0 63 13.5 64 8.5 65 7.0 66 6.0 67 6.0 68 4.0 69 2.0 70 2.5 71 1.5 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.0 30 0.025 31 0.025 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.40221216691804923 0.8 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTA 5 0.125 TruSeq Adapter, Index 4 (100% over 47bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.175 0.0 0.0 0.0 0.0 24 0.175 0.0 0.0 0.0 0.0 25 0.175 0.0 0.0 0.0 0.0 26 0.175 0.0 0.0 0.0 0.0 27 0.2 0.0 0.0 0.0 0.0 28 0.2 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.2 0.0 0.0 0.0 0.0 32 0.2 0.0 0.0 0.0 0.0 33 0.2 0.0 0.0 0.0 0.0 34 0.2 0.0 0.0 0.0 0.0 35 0.2 0.0 0.0 0.0 0.0 36 0.2 0.0 0.0 0.0 0.0 37 0.2 0.0 0.0 0.0 0.0 38 0.2 0.0 0.0 0.0 0.0 39 0.2 0.0 0.0 0.0 0.0 40 0.2 0.0 0.0 0.0 0.0 41 0.2 0.0 0.0 0.0 0.0 42 0.2 0.0 0.0 0.0 0.0 43 0.2 0.0 0.0 0.0 0.0 44 0.2 0.0 0.0 0.0 0.0 45 0.2 0.0 0.0 0.0 0.0 46 0.2 0.0 0.0 0.0 0.0 47 0.2 0.0 0.0 0.0 0.0 48 0.2 0.0 0.0 0.0 0.0 49 0.2 0.0 0.0 0.0 0.0 50 0.2 0.0 0.0 0.0 0.0 51 0.2 0.0 0.0 0.0 0.0 52 0.2 0.0 0.0 0.0 0.0 53 0.2 0.0 0.0 0.0 0.0 54 0.2 0.0 0.0 0.0 0.0 55 0.2 0.0 0.0 0.0 0.0 56 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra Read 297736 spots for SRR3207720.sra Written 297736 spots for SRR3207720.sra Read 297728 spots for SRR3207720.sra Written 297728 spots for SRR3207720.sra SRR ids: ['SRR3207720.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gt9zkn49 SRR3207720.sra spots: 5954568 blocks: [[1, 297728], [297729, 595456], [595457, 893184], [893185, 1190912], [1190913, 1488640], [1488641, 1786368], [1786369, 2084096], [2084097, 2381824], [2381825, 2679552], [2679553, 2977280], [2977281, 3275008], [3275009, 3572736], [3572737, 3870464], [3870465, 4168192], [4168193, 4465920], [4465921, 4763648], [4763649, 5061376], [5061377, 5359104], [5359105, 5656832], [5656833, 5954568]] SRR3207720 file size 1250166 SRR3207720 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207720 SRR3207720_1.fastq Input file: SRR3207720_1.fastq trimmed: SRR3207720-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:29:58 2025 >> started Mon Feb 10 16:30:01 2025 >> done (2.876s) 5954568 reads processed; of these: 13767 ( 0.23%) short reads filtered out after trimming by size control 25104 ( 0.42%) empty reads filtered out after trimming by size control 5915697 (99.35%) reads available; of these: 475407 ( 8.04%) trimmed reads available after processing 5440290 (91.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1572 0.03% 19 2775 0.05% 20 21600 0.37% 21 1498 0.03% 22 1716 0.03% 23 2727 0.05% 24 4650 0.08% 25 7548 0.13% 26 2376 0.04% 27 2700 0.05% 28 3540 0.06% 29 5315 0.09% 30 8478 0.14% 31 2250 0.04% 32 2739 0.05% 33 3621 0.06% 34 5248 0.09% 35 8072 0.14% 36 2031 0.03% 37 2730 0.05% 38 3664 0.06% 39 5617 0.09% 40 8670 0.15% 41 2132 0.04% 42 2968 0.05% 43 4934 0.08% 44 7330 0.12% 45 11652 0.20% 46 2619 0.04% 47 3633 0.06% 48 5749 0.10% 49 10130 0.17% 50 16495 0.28% 51 3915 0.07% 52 5984 0.10% 53 9345 0.16% 54 15431 0.26% 55 28134 0.48% 56 5793 0.10% 57 8258 0.14% 58 12702 0.21% 59 21362 0.36% 60 38770 0.66% 61 7865 0.13% 62 11168 0.19% 63 17554 0.30% 64 29987 0.51% 65 51755 0.87% 66 10691 0.18% 67 17914 0.30% 68 5440290 91.96% 5915697 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=14.26 fanout-score-rank=12 prefix-density=0.08 prefix-fanout=6.3 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=165.96 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=19.5 sequence=TTCTTCTTCTTT Started job on | Feb 10 16:30:15 Started mapping on | Feb 10 16:30:16 Finished on | Feb 10 16:30:22 Mapping speed, Million of reads per hour | 3549.42 Number of input reads | 5915697 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5563264 Uniquely mapped reads % | 94.04% Average mapped length | 66.77 Number of splices: Total | 1021533 Number of splices: Annotated (sjdb) | 1002880 Number of splices: GT/AG | 1005098 Number of splices: GC/AG | 13798 Number of splices: AT/AC | 1222 Number of splices: Non-canonical | 1415 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205222 % of reads mapped to multiple loci | 3.47% Number of reads mapped to too many loci | 119598 % of reads mapped to too many loci | 2.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 147211 147211 147211 N_multimapping 205222 205222 205222 N_noFeature 302038 2886866 2943079 N_ambiguous 53084 8717 9078 UnstrandedReadsAssigned:5208142 PositiveStrandReadsAssigned:2667681 NegativeStrandReadsAssigned:2611107 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207720 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207720-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,915,697 reads, 5,398,364 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR3207720.ke.tsv 34699 SRR3207720.se.tsv 87100 total ==> SRR3207720.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 223 31.5916 Potri.005G024800.1.v4.1 1035 936 66 19.1695 Potri.004G059700.1.v4.1 961 862 10 3.15381 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 105.217 10.0577 Potri.016G087400.1.v4.1 270 171 172 273.448 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23.4728 3.81198 Potri.012G127500.1.v4.1 977 878 933 288.888 ==> SRR3207720.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 789 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 93 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207720 completed mapping pipeline successfully