Starting /dee2/code/volunteer_pipeline.sh SRR3207722 current disk space = 3058157641728 free memory = 1570159036 SRR3207722 SRAfilesize 0d9daab14882c22ffa78160c121741bf SRR3207722.sra SRR3207722.sra file validated SRR3207722 is single end SRR3207722 is conventional basespace SRR3207722 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207722_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66125 34.0 31.0 34.0 31.0 34.0 2 32.472 34.0 33.0 34.0 31.0 34.0 3 33.029 34.0 33.0 34.0 31.0 34.0 4 36.49725 37.0 37.0 37.0 35.0 37.0 5 36.4455 37.0 37.0 37.0 35.0 37.0 6 36.23125 37.0 37.0 37.0 35.0 37.0 7 36.3995 37.0 37.0 37.0 35.0 37.0 8 36.3135 37.0 37.0 37.0 35.0 37.0 9 38.30725 39.0 39.0 39.0 37.0 39.0 10-11 38.365 39.0 39.0 39.0 37.0 39.0 12-13 38.19725 39.0 39.0 39.0 37.0 39.0 14-15 39.79025 41.0 40.0 41.0 37.5 41.0 16-17 39.88275 41.0 40.0 41.0 38.0 41.0 18-19 39.713375 41.0 40.0 41.0 37.5 41.0 20-21 39.575375 41.0 40.0 41.0 36.5 41.0 22-23 39.384874999999994 41.0 39.0 41.0 36.5 41.0 24-25 39.14375 41.0 39.0 41.0 35.5 41.0 26-27 38.353 40.0 38.0 41.0 33.5 41.0 28-29 38.385875 40.0 38.0 41.0 33.5 41.0 30-31 38.311 40.0 38.0 41.0 34.0 41.0 32-33 38.353875 40.0 38.0 41.0 34.0 41.0 34-35 38.235875 40.0 38.0 41.0 33.5 41.0 36-37 38.155874999999995 40.0 38.0 41.0 33.0 41.0 38-39 38.872249999999994 41.0 39.0 41.0 35.5 41.0 40-41 38.78 41.0 39.0 41.0 35.0 41.0 42-43 38.62412500000001 41.0 39.0 41.0 35.0 41.0 44-45 38.586625 40.5 38.5 41.0 34.5 41.0 46-47 37.951 40.0 38.5 41.0 33.0 41.0 48-49 37.994 40.0 38.0 41.0 33.0 41.0 50-51 37.9945 40.0 38.0 41.0 33.5 41.0 52-53 37.97825 40.0 38.0 41.0 33.0 41.0 54-55 37.79875 40.0 38.0 41.0 33.0 41.0 56-57 37.356624999999994 40.0 37.5 41.0 32.0 41.0 58-59 36.544375 39.5 36.0 41.0 29.5 41.0 60-61 36.395250000000004 39.0 36.0 41.0 29.5 41.0 62-63 36.175125 39.0 35.5 41.0 29.5 41.0 64-65 35.811375 39.0 35.0 41.0 29.0 41.0 66-67 35.472625 38.0 35.0 40.0 29.0 41.0 68-69 34.297125 37.0 34.0 39.5 25.0 41.0 70-71 34.032 37.0 34.0 39.0 26.0 41.0 72-73 33.73625 36.0 33.5 39.0 26.0 40.5 74-75 33.417625 36.0 34.0 38.5 25.5 40.0 76-77 32.330375000000004 35.0 32.5 37.0 25.5 39.0 78-79 32.7445 35.0 33.5 37.0 26.0 39.0 80-81 32.450375 35.0 33.0 36.0 26.0 38.0 82-83 32.0525 35.0 33.0 36.0 25.0 37.0 84-85 31.711375 35.0 33.0 36.0 24.0 37.0 86-87 31.06825 35.0 32.5 35.0 21.0 36.0 88-89 30.083750000000002 34.0 31.0 35.0 7.0 36.0 90-91 29.975749999999998 34.5 31.0 35.0 4.5 36.0 92-93 29.0705 34.0 29.5 35.0 2.0 35.0 94-95 28.5915 34.0 29.0 35.0 2.0 35.0 96-97 28.536625 34.0 29.5 35.0 2.0 35.0 98-99 28.673375 34.0 30.0 35.0 2.0 35.0 100 28.2815 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 3.0 10 7.0 11 12.0 12 6.0 13 8.0 14 9.0 15 10.0 16 10.0 17 16.0 18 15.0 19 18.0 20 15.0 21 25.0 22 30.0 23 21.0 24 20.0 25 31.0 26 37.0 27 34.0 28 41.0 29 52.0 30 73.0 31 74.0 32 93.0 33 118.0 34 167.0 35 202.0 36 398.0 37 862.0 38 1283.0 39 307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.63039497776615 15.53753596651844 16.034527857703374 37.79754119801203 2 19.5 23.95 37.075 19.475 3 22.400000000000002 27.224999999999998 27.775 22.6 4 24.6 33.15 19.5 22.75 5 24.125 37.625 20.525 17.724999999999998 6 18.675 39.625 21.425 20.275000000000002 7 17.0 17.849999999999998 43.375 21.775 8 18.275 23.724999999999998 28.775000000000002 29.225 9 19.8 23.799999999999997 30.049999999999997 26.35 10-11 22.4375 34.25 21.637500000000003 21.675 12-13 20.0375 26.05 30.65 23.2625 14-15 21.7375 27.925 28.65 21.6875 16-17 21.6625 27.712500000000002 28.325 22.3 18-19 21.512500000000003 27.8375 27.6 23.05 20-21 21.987499999999997 27.437499999999996 27.55 23.025000000000002 22-23 21.775 29.099999999999998 27.575 21.55 24-25 21.9625 28.95 26.9625 22.125 26-27 22.3625 27.950000000000003 27.6625 22.025 28-29 22.0 27.6125 27.875 22.5125 30-31 21.45 27.9375 28.1875 22.425 32-33 21.775 28.000000000000004 28.0625 22.162499999999998 34-35 22.6375 27.425 27.525 22.412499999999998 36-37 22.35 28.262500000000003 26.75 22.6375 38-39 21.1625 27.85 28.7375 22.25 40-41 22.4875 28.1 26.987499999999997 22.425 42-43 21.0 28.275 27.712500000000002 23.0125 44-45 22.175 27.6625 27.375 22.787499999999998 46-47 21.95 28.375 27.925 21.75 48-49 21.9 27.6625 28.3375 22.1 50-51 22.025 27.762500000000003 27.175 23.0375 52-53 21.6625 28.4 27.725 22.2125 54-55 21.85 27.950000000000003 28.175 22.025 56-57 21.980495123780948 28.057014253563388 27.906976744186046 22.05551387846962 58-59 22.3 26.6125 28.0875 23.0 60-61 21.2625 27.700000000000003 28.1625 22.875 62-63 21.8125 27.6875 27.8375 22.662499999999998 64-65 22.0625 27.9375 27.625 22.375 66-67 21.224999999999998 28.0625 28.3375 22.375 68-69 21.9375 27.525 27.825 22.7125 70-71 21.775 28.3375 27.875 22.0125 72-73 21.375 28.1875 28.15 22.287499999999998 74-75 21.7375 28.4125 27.650000000000002 22.2 76-77 21.5625 26.825 28.749999999999996 22.8625 78-79 21.2875 27.8125 28.3625 22.537499999999998 80-81 22.25 27.275 28.1875 22.287499999999998 82-83 21.75 27.750000000000004 28.4 22.1 84-85 20.880220055013755 28.394598649662417 28.28207051762941 22.443110777694425 86-87 22.06525815726966 28.89111138892362 26.95336917114639 22.090261282660332 88-89 22.1 28.1 27.375 22.425 90-91 22.025 27.700000000000003 27.6125 22.662499999999998 92-93 21.6125 28.4 28.5875 21.4 94-95 21.6625 27.875 27.6625 22.8 96-97 22.4375 27.3 28.050000000000004 22.2125 98-99 22.1875 27.212500000000002 28.3375 22.2625 100 22.075 27.525 27.875 22.525000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 2.5 26 1.5 27 6.0 28 12.5 29 15.5 30 21.0 31 26.0 32 30.0 33 41.0 34 55.0 35 64.5 36 78.0 37 112.0 38 146.0 39 171.5 40 198.0 41 229.5 42 252.0 43 257.5 44 260.0 45 269.5 46 246.5 47 223.0 48 225.0 49 205.5 50 173.5 51 140.0 52 113.5 53 85.5 54 69.5 55 54.0 56 36.0 57 28.5 58 23.5 59 18.5 60 13.5 61 13.0 62 12.5 63 11.0 64 8.5 65 5.0 66 3.0 67 5.0 68 5.5 69 3.5 70 1.5 71 1.0 72 3.0 73 2.0 74 1.5 75 2.5 76 2.5 77 1.5 78 1.0 79 1.5 80 1.0 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.025 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0125 0.0 0.0 0.0 28-29 0.025 0.025 0.0 0.0 0.0 30-31 0.025 0.025 0.0 0.0 0.0 32-33 0.025 0.025 0.0 0.0 0.0 34-35 0.025 0.025 0.0 0.0 0.0 36-37 0.025 0.025 0.0 0.0 0.0 38-39 0.025 0.025 0.0 0.0 0.0 40-41 0.025 0.025 0.0 0.0 0.0 42-43 0.025 0.025 0.0 0.0 0.0 44-45 0.025 0.025 0.0 0.0 0.0 46-47 0.025 0.025 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.037500000000000006 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.0625 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88 0.075 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122725 spots for SRR3207722.sra Written 1122725 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra Read 1122723 spots for SRR3207722.sra Written 1122723 spots for SRR3207722.sra SRR ids: ['SRR3207722.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h_18thgj SRR3207722.sra spots: 22454462 blocks: [[1, 1122723], [1122724, 2245446], [2245447, 3368169], [3368170, 4490892], [4490893, 5613615], [5613616, 6736338], [6736339, 7859061], [7859062, 8981784], [8981785, 10104507], [10104508, 11227230], [11227231, 12349953], [12349954, 13472676], [13472677, 14595399], [14595400, 15718122], [15718123, 16840845], [16840846, 17963568], [17963569, 19086291], [19086292, 20209014], [20209015, 21331737], [21331738, 22454462]] SRR3207722 file size 5832765 SRR3207722 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207722 SRR3207722_1.fastq Input file: SRR3207722_1.fastq trimmed: SRR3207722-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:15:46 2025 >> started Mon Feb 10 17:15:58 2025 >> done (11.424s) 22454462 reads processed; of these: 4815 ( 0.02%) short reads filtered out after trimming by size control 11126 ( 0.05%) empty reads filtered out after trimming by size control 22438521 (99.93%) reads available; of these: 2128884 ( 9.49%) trimmed reads available after processing 20309637 (90.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1248 0.01% 19 1743 0.01% 20 2517 0.01% 21 3481 0.02% 22 4764 0.02% 23 7016 0.03% 24 9833 0.04% 25 12736 0.06% 26 12570 0.06% 27 12252 0.05% 28 12420 0.06% 29 12937 0.06% 30 13659 0.06% 31 13569 0.06% 32 13953 0.06% 33 13575 0.06% 34 14269 0.06% 35 14237 0.06% 36 14945 0.07% 37 15083 0.07% 38 15498 0.07% 39 15642 0.07% 40 16118 0.07% 41 16710 0.07% 42 17508 0.08% 43 17912 0.08% 44 17943 0.08% 45 18348 0.08% 46 18631 0.08% 47 18540 0.08% 48 18678 0.08% 49 18985 0.08% 50 19173 0.09% 51 19770 0.09% 52 19642 0.09% 53 19173 0.09% 54 19622 0.09% 55 19644 0.09% 56 19578 0.09% 57 19679 0.09% 58 19619 0.09% 59 19905 0.09% 60 19848 0.09% 61 19652 0.09% 62 19980 0.09% 63 19794 0.09% 64 19979 0.09% 65 20662 0.09% 66 21033 0.09% 67 21918 0.10% 68 21744 0.10% 69 21421 0.10% 70 23145 0.10% 71 22867 0.10% 72 23148 0.10% 73 23807 0.11% 74 23470 0.10% 75 24872 0.11% 76 16807 0.07% 77 19353 0.09% 78 21587 0.10% 79 23035 0.10% 80 24138 0.11% 81 25378 0.11% 82 26412 0.12% 83 27671 0.12% 84 28778 0.13% 85 29955 0.13% 86 31040 0.14% 87 32641 0.15% 88 34588 0.15% 89 37049 0.17% 90 40796 0.18% 91 45442 0.20% 92 50809 0.23% 93 57782 0.26% 94 67398 0.30% 95 80699 0.36% 96 90585 0.40% 97 114229 0.51% 98 123183 0.55% 99 119064 0.53% 100 20309637 90.51% 22438521 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=18 prefix-density=0.03 prefix-fanout=3.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=165.49 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=22.5 sequence=AAGAAGAAGAAA Started job on | Feb 10 17:16:29 Started mapping on | Feb 10 17:16:31 Finished on | Feb 10 17:16:55 Mapping speed, Million of reads per hour | 3365.78 Number of input reads | 22438521 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 21118029 Uniquely mapped reads % | 94.12% Average mapped length | 97.54 Number of splices: Total | 5780418 Number of splices: Annotated (sjdb) | 5676985 Number of splices: GT/AG | 5695876 Number of splices: GC/AG | 69148 Number of splices: AT/AC | 5613 Number of splices: Non-canonical | 9781 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 537105 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 660410 % of reads mapped to too many loci | 2.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 783387 783387 783387 N_multimapping 537105 537105 537105 N_noFeature 950765 10923815 10993761 N_ambiguous 222741 35644 36129 UnstrandedReadsAssigned:19944523 PositiveStrandReadsAssigned:10158570 NegativeStrandReadsAssigned:10088139 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207722 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207722-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,438,521 reads, 20,817,817 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR3207722.ke.tsv 34699 SRR3207722.se.tsv 87100 total ==> SRR3207722.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 712 26.0236 Potri.005G024800.1.v4.1 1035 936 91 6.81911 Potri.004G059700.1.v4.1 961 862 47 3.82431 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 336.135 8.28983 Potri.016G087400.1.v4.1 270 171 914 374.897 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 48 2.01117 Potri.012G127500.1.v4.1 977 878 2422 193.483 ==> SRR3207722.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2077 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 332 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 40 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR3207722 completed mapping pipeline successfully