Starting /dee2/code/volunteer_pipeline.sh SRR3207723 current disk space = 3058036568064 free memory = 1580140952 SRR3207723 SRAfilesize 224256d7a4bb7a00f7509062dbefb09c SRR3207723.sra SRR3207723.sra file validated SRR3207723 is single end SRR3207723 is conventional basespace SRR3207723 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207723_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98375 34.0 31.0 34.0 31.0 34.0 2 32.6985 34.0 33.0 34.0 31.0 34.0 3 33.1355 34.0 34.0 34.0 31.0 34.0 4 36.56325 37.0 37.0 37.0 35.0 37.0 5 36.49 37.0 37.0 37.0 35.0 37.0 6 36.22225 37.0 37.0 37.0 35.0 37.0 7 36.405 37.0 37.0 37.0 35.0 37.0 8 36.33875 37.0 37.0 37.0 35.0 37.0 9 38.316 39.0 39.0 39.0 37.0 39.0 10-11 38.378 39.0 39.0 39.0 37.0 39.0 12-13 38.266125 39.0 39.0 39.0 37.0 39.0 14-15 39.870625000000004 41.0 40.0 41.0 37.5 41.0 16-17 39.958625 41.0 40.0 41.0 38.0 41.0 18-19 39.858375 41.0 40.0 41.0 38.0 41.0 20-21 39.675625 41.0 40.0 41.0 37.5 41.0 22-23 39.45 41.0 39.5 41.0 36.5 41.0 24-25 39.2505 41.0 39.0 41.0 36.0 41.0 26-27 38.45375 40.0 38.0 41.0 33.5 41.0 28-29 38.587875 40.0 38.0 41.0 34.5 41.0 30-31 38.494749999999996 40.0 38.0 41.0 34.0 41.0 32-33 38.57575 40.0 38.0 41.0 34.5 41.0 34-35 38.44975 40.0 38.0 41.0 34.5 41.0 36-37 38.21975 40.0 38.5 41.0 33.5 41.0 38-39 38.94375 41.0 39.0 41.0 35.5 41.0 40-41 38.866625 41.0 39.0 41.0 35.5 41.0 42-43 38.651125 41.0 39.0 41.0 35.0 41.0 44-45 38.621125000000006 41.0 39.0 41.0 35.0 41.0 46-47 38.154250000000005 40.5 38.5 41.0 33.5 41.0 48-49 38.162375 40.0 38.0 41.0 33.5 41.0 50-51 38.16 40.0 38.0 41.0 34.0 41.0 52-53 38.159 40.0 38.0 41.0 34.0 41.0 54-55 37.998374999999996 40.0 38.0 41.0 33.5 41.0 56-57 37.676874999999995 40.0 38.0 41.0 33.5 41.0 58-59 36.912375 40.0 36.5 41.0 31.0 41.0 60-61 36.693124999999995 40.0 36.0 41.0 30.5 41.0 62-63 36.514624999999995 39.0 36.0 41.0 30.0 41.0 64-65 36.21625 39.0 35.5 41.0 30.5 41.0 66-67 35.8885 38.5 35.0 40.0 29.5 41.0 68-69 34.7305 37.0 34.0 40.0 26.5 41.0 70-71 34.48775 37.0 34.0 39.0 26.5 41.0 72-73 34.24875 36.5 34.0 39.0 27.0 40.5 74-75 33.773375 36.0 34.0 38.5 26.5 40.0 76-77 32.674125000000004 35.0 32.5 37.0 26.0 39.0 78-79 33.13275 35.0 33.5 37.0 27.5 39.0 80-81 32.805499999999995 35.0 33.5 36.5 26.5 38.5 82-83 32.461625 35.0 33.5 36.0 26.0 37.0 84-85 32.119375 35.0 33.0 36.0 25.5 37.0 86-87 31.493000000000002 35.0 32.5 35.0 23.5 36.0 88-89 30.536875000000002 34.5 31.0 35.0 18.5 36.0 90-91 30.312375 34.5 31.5 35.0 12.5 36.0 92-93 29.294249999999998 34.0 30.0 35.0 4.5 35.0 94-95 28.918 34.0 29.0 35.0 2.0 35.0 96-97 28.883375 34.0 29.5 35.0 2.0 35.0 98-99 29.02675 34.0 30.5 35.0 2.0 35.0 100 28.678 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 5.0 11 11.0 12 8.0 13 5.0 14 9.0 15 12.0 16 8.0 17 15.0 18 12.0 19 15.0 20 16.0 21 15.0 22 17.0 23 19.0 24 17.0 25 21.0 26 42.0 27 36.0 28 39.0 29 54.0 30 61.0 31 73.0 32 79.0 33 119.0 34 154.0 35 250.0 36 386.0 37 796.0 38 1376.0 39 325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.24915737619912 13.19678506611356 17.24137931034483 42.3126782473425 2 20.1 23.925 35.325 20.65 3 22.725 26.825 28.299999999999997 22.15 4 25.525 31.85 19.950000000000003 22.675 5 24.15 35.775 22.375 17.7 6 17.825 37.25 24.025 20.9 7 15.75 17.65 44.975 21.625 8 19.925 23.225 29.375 27.474999999999998 9 20.599999999999998 22.95 32.15 24.3 10-11 22.325 33.7375 21.975 21.9625 12-13 20.0875 27.900000000000002 29.6625 22.35 14-15 21.1375 28.725 28.762500000000003 21.375 16-17 22.3375 28.012500000000003 27.8625 21.7875 18-19 21.3875 27.6125 28.012500000000003 22.9875 20-21 20.6625 28.7375 27.737499999999997 22.8625 22-23 22.025 27.962500000000002 28.575 21.4375 24-25 21.4125 29.25 26.950000000000003 22.3875 26-27 21.2375 28.462500000000002 27.800000000000004 22.5 28-29 22.75 27.975 27.6125 21.6625 30-31 20.9125 28.825 27.762500000000003 22.5 32-33 21.125 28.1875 27.6375 23.05 34-35 21.625 28.4375 27.900000000000002 22.037499999999998 36-37 21.75 29.15 27.762500000000003 21.337500000000002 38-39 21.712500000000002 28.549999999999997 27.875 21.8625 40-41 22.2125 28.575 27.250000000000004 21.9625 42-43 21.987499999999997 27.6375 28.4125 21.9625 44-45 21.05 28.549999999999997 27.750000000000004 22.650000000000002 46-47 21.625 28.749999999999996 27.8125 21.8125 48-49 21.530382595648913 29.057264316079017 27.60690172543136 21.80545136284071 50-51 21.8625 28.499999999999996 27.900000000000002 21.7375 52-53 21.75 27.425 28.799999999999997 22.025 54-55 21.802725340667585 27.628453556694588 28.56607075884486 22.00275034379297 56-57 22.32087032637239 28.073027385269476 28.23558834562961 21.370513942728522 58-59 21.625 28.1125 27.712500000000002 22.55 60-61 21.425 28.3375 28.525 21.712500000000002 62-63 21.75 28.6625 27.3375 22.25 64-65 22.45 28.65 27.487499999999997 21.4125 66-67 21.525 28.037499999999998 28.425 22.0125 68-69 22.525000000000002 28.625 27.287499999999998 21.5625 70-71 21.6 28.3625 27.537499999999998 22.5 72-73 21.99299824956239 28.482120530132534 27.631907976994246 21.892973243310827 74-75 22.26528316039505 28.55356919614952 27.94099262407801 21.240155019377422 76-77 22.327790973871732 28.128516064508062 27.340917614701837 22.202775346918365 78-79 22.36118059029515 28.12656328164082 27.60130065032516 21.91095547773887 80-81 21.980495123780948 27.60690172543136 28.28207051762941 22.13053263315829 82-83 21.765220652581576 28.403550443805475 27.353419177397175 22.477809726215778 84-85 21.691268451338505 28.183637728296222 28.621466099574683 21.503627720790593 86-87 22.158309366012254 29.02338376891334 27.11016631236714 21.708140552707263 88-89 21.7875 28.487499999999997 28.1875 21.5375 90-91 22.125 28.0625 27.737499999999997 22.075 92-93 22.2125 27.9125 27.8625 22.0125 94-95 20.549999999999997 28.9125 28.475 22.0625 96-97 22.490311288911112 27.765970746343292 28.141017627203404 21.602700337542196 98-99 22.925 27.750000000000004 27.700000000000003 21.625 100 22.425 27.700000000000003 27.125 22.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 2.5 24 3.5 25 2.5 26 4.5 27 7.5 28 11.0 29 13.0 30 15.5 31 20.5 32 29.0 33 45.5 34 55.0 35 64.0 36 95.0 37 121.0 38 151.0 39 187.5 40 211.0 41 229.5 42 242.0 43 250.5 44 257.5 45 282.5 46 275.5 47 245.0 48 213.5 49 177.5 50 152.5 51 126.5 52 111.5 53 98.5 54 74.0 55 50.0 56 35.0 57 26.0 58 22.5 59 16.5 60 13.0 61 12.0 62 8.5 63 7.5 64 6.5 65 4.5 66 3.0 67 1.5 68 2.0 69 1.5 70 0.5 71 1.0 72 1.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.025 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0375 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.025 74-75 0.0125 76-77 0.0125 78-79 0.05 80-81 0.025 82-83 0.0125 84-85 0.075 86-87 0.0375 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960049 spots for SRR3207723.sra Written 960049 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra Read 960032 spots for SRR3207723.sra Written 960032 spots for SRR3207723.sra SRR ids: ['SRR3207723.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjzhvq7s SRR3207723.sra spots: 19200657 blocks: [[1, 960032], [960033, 1920064], [1920065, 2880096], [2880097, 3840128], [3840129, 4800160], [4800161, 5760192], [5760193, 6720224], [6720225, 7680256], [7680257, 8640288], [8640289, 9600320], [9600321, 10560352], [10560353, 11520384], [11520385, 12480416], [12480417, 13440448], [13440449, 14400480], [14400481, 15360512], [15360513, 16320544], [16320545, 17280576], [17280577, 18240608], [18240609, 19200657]] SRR3207723 file size 4985985 SRR3207723 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207723 SRR3207723_1.fastq Input file: SRR3207723_1.fastq trimmed: SRR3207723-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:27:41 2025 >> started Mon Feb 10 17:27:50 2025 >> done (9.477s) 19200657 reads processed; of these: 3174 ( 0.02%) short reads filtered out after trimming by size control 4463 ( 0.02%) empty reads filtered out after trimming by size control 19193020 (99.96%) reads available; of these: 1737764 ( 9.05%) trimmed reads available after processing 17455256 (90.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 887 0.00% 19 1293 0.01% 20 1886 0.01% 21 2647 0.01% 22 3624 0.02% 23 5292 0.03% 24 7435 0.04% 25 9982 0.05% 26 9795 0.05% 27 9605 0.05% 28 9836 0.05% 29 10405 0.05% 30 10625 0.06% 31 10891 0.06% 32 11044 0.06% 33 10880 0.06% 34 11256 0.06% 35 11346 0.06% 36 12215 0.06% 37 12043 0.06% 38 12006 0.06% 39 12287 0.06% 40 12982 0.07% 41 13157 0.07% 42 13919 0.07% 43 14222 0.07% 44 14506 0.08% 45 14765 0.08% 46 15248 0.08% 47 14767 0.08% 48 15027 0.08% 49 15513 0.08% 50 15525 0.08% 51 15740 0.08% 52 15772 0.08% 53 15738 0.08% 54 15886 0.08% 55 15770 0.08% 56 15656 0.08% 57 16009 0.08% 58 15741 0.08% 59 16189 0.08% 60 16062 0.08% 61 16075 0.08% 62 16198 0.08% 63 16099 0.08% 64 16419 0.09% 65 16796 0.09% 66 17204 0.09% 67 17754 0.09% 68 18108 0.09% 69 17714 0.09% 70 18575 0.10% 71 18326 0.10% 72 19051 0.10% 73 19296 0.10% 74 19419 0.10% 75 20064 0.10% 76 13816 0.07% 77 15595 0.08% 78 17511 0.09% 79 19013 0.10% 80 19591 0.10% 81 20633 0.11% 82 21137 0.11% 83 22502 0.12% 84 23626 0.12% 85 24601 0.13% 86 25268 0.13% 87 26758 0.14% 88 28390 0.15% 89 30614 0.16% 90 33610 0.18% 91 37307 0.19% 92 41867 0.22% 93 47362 0.25% 94 56199 0.29% 95 66535 0.35% 96 75791 0.39% 97 95794 0.50% 98 102938 0.54% 99 98734 0.51% 100 17455256 90.95% 19193020 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=50.75 fanout-score-rank=8 prefix-density=0.43 prefix-fanout=35.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=16 fanout-score=160.20 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=21.4 sequence=AAGAAGAAGAAA Started job on | Feb 10 17:28:13 Started mapping on | Feb 10 17:28:14 Finished on | Feb 10 17:28:32 Mapping speed, Million of reads per hour | 3838.60 Number of input reads | 19193020 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 18430602 Uniquely mapped reads % | 96.03% Average mapped length | 97.51 Number of splices: Total | 5226306 Number of splices: Annotated (sjdb) | 5135244 Number of splices: GT/AG | 5151545 Number of splices: GC/AG | 61540 Number of splices: AT/AC | 4882 Number of splices: Non-canonical | 8339 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434821 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 230085 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327597 327597 327597 N_multimapping 434821 434821 434821 N_noFeature 780432 9517330 9567937 N_ambiguous 186463 29813 31138 UnstrandedReadsAssigned:17463707 PositiveStrandReadsAssigned:8883459 NegativeStrandReadsAssigned:8831527 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207723 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207723-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,193,020 reads, 17,904,109 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR3207723.ke.tsv 34699 SRR3207723.se.tsv 87100 total ==> SRR3207723.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 524 22.64 Potri.005G024800.1.v4.1 1035 936 62.0097 5.49294 Potri.004G059700.1.v4.1 961 862 15 1.4428 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 309.377 9.01943 Potri.016G087400.1.v4.1 270 171 846 410.199 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 63 3.12037 Potri.012G127500.1.v4.1 977 878 2201 207.848 ==> SRR3207723.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2005 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207723 completed mapping pipeline successfully