Starting /dee2/code/volunteer_pipeline.sh SRR3207724 current disk space = 3058061996032 free memory = 1570928012 SRR3207724 SRAfilesize 0033d6800f7169400356e944da9348db SRR3207724.sra SRR3207724.sra file validated SRR3207724 is single end SRR3207724 is conventional basespace SRR3207724 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207724_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49075 34.0 31.0 34.0 31.0 34.0 2 32.404 34.0 33.0 34.0 31.0 34.0 3 33.022 34.0 33.0 34.0 31.0 34.0 4 36.5195 37.0 37.0 37.0 35.0 37.0 5 36.4505 37.0 37.0 37.0 35.0 37.0 6 36.16525 37.0 37.0 37.0 35.0 37.0 7 36.42375 37.0 37.0 37.0 35.0 37.0 8 36.30725 37.0 37.0 37.0 35.0 37.0 9 38.35675 39.0 39.0 39.0 37.0 39.0 10-11 38.40625 39.0 39.0 39.0 37.0 39.0 12-13 38.271875 39.0 39.0 39.0 37.0 39.0 14-15 39.942125000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.92275 41.0 40.0 41.0 38.0 41.0 18-19 39.852125 41.0 40.0 41.0 38.0 41.0 20-21 39.701125000000005 41.0 40.0 41.0 37.5 41.0 22-23 39.550125 41.0 40.0 41.0 37.0 41.0 24-25 39.326 41.0 39.0 41.0 36.5 41.0 26-27 38.521375 40.0 38.0 41.0 34.0 41.0 28-29 38.615375 40.0 38.5 41.0 34.5 41.0 30-31 38.53875 40.0 38.0 41.0 34.5 41.0 32-33 38.531625 40.0 38.0 41.0 34.5 41.0 34-35 38.424625 40.0 38.0 41.0 34.0 41.0 36-37 38.320875 40.5 38.5 41.0 34.0 41.0 38-39 38.87675 41.0 39.0 41.0 35.5 41.0 40-41 38.81375 41.0 39.0 41.0 35.5 41.0 42-43 38.638125 41.0 39.0 41.0 35.0 41.0 44-45 38.561875 41.0 39.0 41.0 35.0 41.0 46-47 38.17425 40.5 38.5 41.0 33.5 41.0 48-49 38.112375 40.0 38.0 41.0 33.5 41.0 50-51 37.957375 40.0 38.0 41.0 33.5 41.0 52-53 37.93025 40.0 38.0 41.0 33.0 41.0 54-55 37.80475 40.0 38.0 41.0 33.0 41.0 56-57 37.429375 40.0 37.5 41.0 32.5 41.0 58-59 36.74275 40.0 36.5 41.0 30.0 41.0 60-61 36.581375 39.5 36.0 41.0 30.0 41.0 62-63 36.308375 39.0 36.0 41.0 30.0 41.0 64-65 36.0065 39.0 35.0 41.0 29.0 41.0 66-67 35.691625 38.5 35.0 40.5 29.5 41.0 68-69 34.744375 37.5 34.5 40.0 26.5 41.0 70-71 34.456125 37.0 34.0 39.0 26.0 41.0 72-73 34.12875 36.5 34.0 39.0 26.5 40.5 74-75 33.7235 36.0 34.0 38.5 26.5 40.0 76-77 32.582375 35.0 32.5 37.0 26.0 39.0 78-79 32.984375 35.0 34.0 37.0 26.0 39.0 80-81 32.62525 35.0 34.0 37.0 26.0 38.5 82-83 32.195750000000004 35.0 33.0 36.0 25.5 37.0 84-85 31.8025 35.0 33.0 36.0 24.5 37.0 86-87 31.226625 35.0 32.5 35.0 21.0 36.5 88-89 30.396625 35.0 31.0 35.0 14.5 36.0 90-91 30.10225 34.5 31.5 35.0 6.0 36.0 92-93 29.314625 34.0 30.0 35.0 2.0 35.0 94-95 29.006625 34.0 29.5 35.0 2.0 35.0 96-97 28.941499999999998 34.0 29.5 35.0 2.0 35.0 98-99 29.08 34.0 30.5 35.0 2.0 35.0 100 28.79475 34.0 31.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 2.0 9 6.0 10 7.0 11 7.0 12 10.0 13 12.0 14 6.0 15 11.0 16 9.0 17 11.0 18 16.0 19 19.0 20 20.0 21 14.0 22 18.0 23 26.0 24 26.0 25 35.0 26 30.0 27 41.0 28 33.0 29 45.0 30 54.0 31 71.0 32 86.0 33 103.0 34 152.0 35 220.0 36 347.0 37 837.0 38 1392.0 39 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.78267758119884 14.840242936361236 14.893055188803803 41.484024293636125 2 18.05 25.05 37.95 18.95 3 21.9 26.575 27.750000000000004 23.775 4 23.724999999999998 34.300000000000004 20.599999999999998 21.375 5 24.306076519129782 36.83420855213804 22.030507626906726 16.829207301825456 6 18.675 37.45 24.3 19.575 7 16.2 18.825 43.175000000000004 21.8 8 19.25 23.9 29.7 27.150000000000002 9 20.65 23.425 30.425 25.5 10-11 22.35 34.449999999999996 22.4375 20.7625 12-13 20.4875 26.3125 30.1375 23.0625 14-15 20.1625 28.050000000000004 28.6125 23.175 16-17 22.537499999999998 28.037499999999998 27.287499999999998 22.1375 18-19 21.975 26.937499999999996 28.475 22.6125 20-21 21.95 28.487499999999997 27.625 21.9375 22-23 21.8625 27.900000000000002 27.500000000000004 22.7375 24-25 21.8 27.775 28.299999999999997 22.125 26-27 21.975 27.900000000000002 28.287499999999998 21.837500000000002 28-29 21.4 29.0875 27.0625 22.45 30-31 22.025 27.8875 27.712500000000002 22.375 32-33 21.8 28.7375 27.625 21.837500000000002 34-35 22.125 29.1875 26.8 21.8875 36-37 21.825 27.85 28.225 22.1 38-39 20.9 28.3625 28.0875 22.650000000000002 40-41 22.2625 28.037499999999998 27.6875 22.0125 42-43 22.325 28.1375 28.487499999999997 21.05 44-45 21.4375 28.575 27.900000000000002 22.0875 46-47 21.925 28.3875 27.725 21.9625 48-49 21.6 29.225 27.700000000000003 21.475 50-51 21.512500000000003 28.549999999999997 28.037499999999998 21.9 52-53 22.237499999999997 28.5875 27.1 22.075 54-55 21.0375 27.787499999999998 28.499999999999996 22.675 56-57 21.29282320580145 28.619654913728432 28.34458614653663 21.742935733933482 58-59 21.462500000000002 28.0625 27.6375 22.8375 60-61 22.162499999999998 28.012500000000003 27.6125 22.2125 62-63 21.4875 28.375 28.125 22.0125 64-65 22.4375 28.825 27.0875 21.65 66-67 21.85 28.999999999999996 27.925 21.224999999999998 68-69 22.3 28.812500000000004 27.075 21.8125 70-71 21.425 28.125 27.3 23.150000000000002 72-73 22.0875 28.3875 27.3375 22.1875 74-75 21.425 28.012500000000003 28.575 21.987499999999997 76-77 23.175 27.0875 27.474999999999998 22.2625 78-79 21.325 28.95 27.287499999999998 22.4375 80-81 22.162499999999998 28.712500000000002 27.700000000000003 21.425 82-83 22.2125 27.925 27.525 22.3375 84-85 21.9375 27.437499999999996 28.287499999999998 22.3375 86-87 21.6125 28.375 27.5625 22.45 88-89 22.425 27.962500000000002 27.3625 22.25 90-91 21.987499999999997 27.6 28.3875 22.025 92-93 22.037499999999998 27.8125 28.349999999999998 21.8 94-95 22.075 27.5625 29.262500000000003 21.099999999999998 96-97 22.537499999999998 27.375 27.725 22.3625 98-99 23.1375 27.462500000000002 28.1375 21.2625 100 22.8 28.199999999999996 26.875 22.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.5 24 2.0 25 3.0 26 4.0 27 3.5 28 9.0 29 17.0 30 22.5 31 27.5 32 36.5 33 46.5 34 56.5 35 82.0 36 101.0 37 112.5 38 139.5 39 161.5 40 191.0 41 225.0 42 249.0 43 273.0 44 272.0 45 255.5 46 242.0 47 226.0 48 218.5 49 203.0 50 171.0 51 142.5 52 116.0 53 85.5 54 68.5 55 55.5 56 33.5 57 25.5 58 23.0 59 15.0 60 11.5 61 9.0 62 6.0 63 8.5 64 9.5 65 6.5 66 4.5 67 1.5 68 0.0 69 0.5 70 1.5 71 3.0 72 3.0 73 1.0 74 1.0 75 2.5 76 2.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.325 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472642 spots for SRR3207724.sra Written 1472642 spots for SRR3207724.sra Read 1472650 spots for SRR3207724.sra Written 1472650 spots for SRR3207724.sra SRR ids: ['SRR3207724.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a6nurrq5 SRR3207724.sra spots: 29452848 blocks: [[1, 1472642], [1472643, 2945284], [2945285, 4417926], [4417927, 5890568], [5890569, 7363210], [7363211, 8835852], [8835853, 10308494], [10308495, 11781136], [11781137, 13253778], [13253779, 14726420], [14726421, 16199062], [16199063, 17671704], [17671705, 19144346], [19144347, 20616988], [20616989, 22089630], [22089631, 23562272], [23562273, 25034914], [25034915, 26507556], [26507557, 27980198], [27980199, 29452848]] SRR3207724 file size 7654050 SRR3207724 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207724 SRR3207724_1.fastq Input file: SRR3207724_1.fastq trimmed: SRR3207724-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:37:14 2025 >> started Mon Feb 10 17:37:28 2025 >> done (14.511s) 29452848 reads processed; of these: 8714 ( 0.03%) short reads filtered out after trimming by size control 34396 ( 0.12%) empty reads filtered out after trimming by size control 29409738 (99.85%) reads available; of these: 2727117 ( 9.27%) trimmed reads available after processing 26682621 (90.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1834 0.01% 19 2494 0.01% 20 12610 0.04% 21 4804 0.02% 22 6032 0.02% 23 8527 0.03% 24 11838 0.04% 25 15875 0.05% 26 16169 0.05% 27 15425 0.05% 28 15847 0.05% 29 16199 0.06% 30 16803 0.06% 31 17353 0.06% 32 17290 0.06% 33 17081 0.06% 34 17803 0.06% 35 18273 0.06% 36 19185 0.07% 37 19256 0.07% 38 19343 0.07% 39 19761 0.07% 40 20638 0.07% 41 21067 0.07% 42 22051 0.07% 43 22653 0.08% 44 22948 0.08% 45 23437 0.08% 46 23389 0.08% 47 23505 0.08% 48 23849 0.08% 49 24250 0.08% 50 24845 0.08% 51 24825 0.08% 52 25059 0.09% 53 24631 0.08% 54 25151 0.09% 55 24925 0.08% 56 25213 0.09% 57 25318 0.09% 58 24995 0.08% 59 25213 0.09% 60 25362 0.09% 61 25188 0.09% 62 25648 0.09% 63 27800 0.09% 64 26056 0.09% 65 26286 0.09% 66 26929 0.09% 67 27461 0.09% 68 28102 0.10% 69 27271 0.09% 70 29092 0.10% 71 28595 0.10% 72 29119 0.10% 73 29869 0.10% 74 29835 0.10% 75 31202 0.11% 76 21710 0.07% 77 24390 0.08% 78 27196 0.09% 79 29487 0.10% 80 30612 0.10% 81 32186 0.11% 82 32989 0.11% 83 35096 0.12% 84 36450 0.12% 85 38290 0.13% 86 39550 0.13% 87 41616 0.14% 88 44083 0.15% 89 47805 0.16% 90 51971 0.18% 91 57757 0.20% 92 65286 0.22% 93 74088 0.25% 94 86695 0.29% 95 103184 0.35% 96 116392 0.40% 97 147736 0.50% 98 157694 0.54% 99 153275 0.52% 100 26682621 90.73% 29409738 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=5.92 fanout-score-rank=23 prefix-density=0.04 prefix-fanout=5.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=260.57 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.6 sequence=TTCTTCTTCTTT Started job on | Feb 10 17:37:49 Started mapping on | Feb 10 17:37:49 Finished on | Feb 10 17:38:14 Mapping speed, Million of reads per hour | 4235.00 Number of input reads | 29409738 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 28209665 Uniquely mapped reads % | 95.92% Average mapped length | 97.52 Number of splices: Total | 8180541 Number of splices: Annotated (sjdb) | 8042728 Number of splices: GT/AG | 8061019 Number of splices: GC/AG | 98873 Number of splices: AT/AC | 7773 Number of splices: Non-canonical | 12876 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 680993 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 356009 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 519080 519080 519080 N_multimapping 680993 680993 680993 N_noFeature 1203484 14574492 14661923 N_ambiguous 269841 46156 47283 UnstrandedReadsAssigned:26736340 PositiveStrandReadsAssigned:13589017 NegativeStrandReadsAssigned:13500459 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207724 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207724-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,409,738 reads, 27,408,586 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR3207724.ke.tsv 34699 SRR3207724.se.tsv 87100 total ==> SRR3207724.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 741.485 21.1042 Potri.005G024800.1.v4.1 1035 936 69 4.02639 Potri.004G059700.1.v4.1 961 862 16 1.01381 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 495.892 9.52357 Potri.016G087400.1.v4.1 270 171 1201 383.61 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 121 3.94796 Potri.012G127500.1.v4.1 977 878 3909 243.172 ==> SRR3207724.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3087 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 425 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207724 completed mapping pipeline successfully