Starting /dee2/code/volunteer_pipeline.sh SRR3207725 current disk space = 3058360729600 free memory = 1143903152 SRR3207725 SRAfilesize 56e71a974f9c10b55e26df91f3cb344b SRR3207725.sra SRR3207725.sra file validated SRR3207725 is single end SRR3207725 is conventional basespace SRR3207725 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207725_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.57775 39.0 38.0 40.0 33.0 40.0 2 37.2905 39.0 37.0 40.0 33.0 40.0 3 37.241 39.0 37.0 40.0 33.0 40.0 4 37.28225 39.0 37.0 40.0 33.0 40.0 5 37.20975 39.0 37.0 40.0 33.0 40.0 6 37.17675 39.0 37.0 40.0 33.0 40.0 7 37.378 39.0 38.0 40.0 33.0 40.0 8 37.203 39.0 36.0 40.0 33.0 40.0 9 37.03925 39.0 36.0 40.0 33.0 40.0 10 37.10575 39.0 36.0 40.0 33.0 40.0 11 37.34675 39.0 37.0 40.0 33.0 40.0 12 37.12025 39.0 36.0 40.0 33.0 40.0 13 37.1345 39.0 36.0 40.0 33.0 40.0 14 37.1435 39.0 36.0 40.0 33.0 40.0 15 37.0235 38.0 36.0 40.0 32.0 40.0 16 36.94675 38.0 36.0 40.0 33.0 40.0 17 36.83425 38.0 36.0 40.0 32.0 40.0 18 36.787 38.0 36.0 40.0 31.0 40.0 19 36.646 38.0 36.0 40.0 31.0 40.0 20 36.641 38.0 35.0 40.0 31.0 40.0 21 36.5625 38.0 36.0 40.0 31.0 40.0 22 36.24875 38.0 35.0 39.0 30.0 40.0 23 36.271 38.0 35.0 39.0 30.0 40.0 24 36.17425 38.0 35.0 39.0 30.0 40.0 25 36.11825 38.0 35.0 39.0 30.0 40.0 26 35.823 38.0 35.0 39.0 30.0 40.0 27 35.63375 38.0 35.0 39.0 29.0 40.0 28 35.48875 38.0 34.0 39.0 29.0 40.0 29 35.257 38.0 34.0 39.0 29.0 40.0 30 35.101 38.0 33.0 39.0 28.0 40.0 31 35.23925 38.0 35.0 39.0 28.0 40.0 32 35.291 38.0 35.0 39.0 29.0 40.0 33 35.08025 38.0 34.0 39.0 27.0 40.0 34 35.014 38.0 34.0 39.0 27.0 40.0 35 34.82 38.0 34.0 39.0 27.0 40.0 36 35.1005 38.0 35.0 39.0 28.0 40.0 37 34.9325 38.0 34.0 39.0 28.0 40.0 38 34.81325 38.0 34.0 39.0 27.0 40.0 39 34.76575 38.0 34.0 39.0 27.0 40.0 40 34.579 38.0 34.0 39.0 27.0 40.0 41 34.478 38.0 34.0 39.0 27.0 40.0 42 34.20125 38.0 33.0 39.0 26.0 40.0 43 34.0945 38.0 33.0 39.0 26.0 40.0 44 33.91475 37.0 33.0 39.0 25.0 40.0 45 33.73975 37.0 33.0 39.0 25.0 40.0 46 33.5565 37.0 33.0 39.0 23.0 40.0 47 33.42575 37.0 33.0 39.0 23.0 40.0 48 33.18775 37.0 33.0 39.0 23.0 40.0 49 32.9775 36.0 32.0 39.0 22.0 40.0 50 32.747 36.0 32.0 39.0 22.0 40.0 51 32.66475 36.0 32.0 39.0 18.0 40.0 52 32.23825 36.0 31.0 39.0 16.0 40.0 53 31.811 36.0 31.0 39.0 13.0 40.0 54 31.74625 36.0 31.0 39.0 14.0 40.0 55 31.73275 36.0 31.0 39.0 11.0 40.0 56 31.40875 36.0 31.0 39.0 2.0 40.0 57 30.87225 35.0 30.0 38.0 2.0 39.0 58 30.8265 35.0 30.0 38.0 2.0 40.0 59 30.621 35.0 30.0 38.0 2.0 39.0 60 30.23425 35.0 29.0 38.0 2.0 39.0 61 29.51425 35.0 29.0 38.0 2.0 39.0 62 29.37275 35.0 29.0 38.0 2.0 39.0 63 28.9625 34.0 28.0 38.0 2.0 39.0 64 28.58725 34.0 27.0 38.0 2.0 39.0 65 28.23675 34.0 27.0 38.0 2.0 39.0 66 27.57775 33.0 25.0 37.0 2.0 39.0 67 27.3515 33.0 24.0 37.0 2.0 39.0 68 26.57725 33.0 22.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 7.0 10 8.0 11 9.0 12 17.0 13 18.0 14 15.0 15 20.0 16 10.0 17 21.0 18 21.0 19 26.0 20 29.0 21 32.0 22 31.0 23 31.0 24 49.0 25 50.0 26 55.0 27 66.0 28 77.0 29 83.0 30 115.0 31 100.0 32 146.0 33 203.0 34 253.0 35 336.0 36 459.0 37 542.0 38 632.0 39 528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.86491935483871 13.230846774193546 17.237903225806452 42.66633064516129 2 22.525000000000002 22.775000000000002 31.775 22.925 3 25.25 27.500000000000004 23.075000000000003 24.175 4 27.025 32.625 17.175 23.175 5 28.7 31.924999999999997 20.275000000000002 19.1 6 20.974999999999998 36.025 23.1 19.900000000000002 7 17.974999999999998 16.0 42.75 23.275000000000002 8 21.95 21.175 26.700000000000003 30.175 9 20.200000000000003 23.3 29.175 27.325 10 21.925 36.575 21.25 20.25 11 25.025 27.35 19.925 27.700000000000003 12 22.525000000000002 21.275 29.525000000000002 26.674999999999997 13 21.15 26.35 28.799999999999997 23.7 14 22.175 25.775 27.675 24.375 15 24.099999999999998 24.7 26.575 24.625 16 23.05 25.724999999999998 27.275 23.95 17 25.074999999999996 25.75 25.074999999999996 24.099999999999998 18 22.825 28.125 26.900000000000002 22.15 19 23.375 26.825 25.724999999999998 24.075 20 24.95 27.025 26.075 21.95 21 24.25 25.75 25.924999999999997 24.075 22 22.05 28.1 25.85 24.0 23 23.45 27.775 27.175 21.6 24 22.55 27.224999999999998 26.3 23.925 25 23.125 26.8 25.674999999999997 24.4 26 24.125 26.825 25.6 23.45 27 23.125 26.450000000000003 27.175 23.25 28 23.75 25.775 25.75 24.725 29 25.124999999999996 25.775 25.025 24.075 30 24.75 26.3 24.925 24.025 31 22.325 27.35 26.775 23.549999999999997 32 23.375 27.700000000000003 25.15 23.775 33 24.25 25.624999999999996 26.025 24.099999999999998 34 22.900000000000002 27.800000000000004 24.95 24.349999999999998 35 23.849999999999998 28.475 25.7 21.975 36 23.400000000000002 27.650000000000002 26.150000000000002 22.8 37 23.325000000000003 27.05 26.525 23.1 38 22.7 27.3 25.7 24.3 39 24.3 27.150000000000002 25.275 23.275000000000002 40 23.875 26.75 25.8 23.575 41 25.03125781445361 26.70667666916729 24.756189047261813 23.50587646911728 42 22.725 27.650000000000002 26.5 23.125 43 23.0 27.250000000000004 26.974999999999998 22.775000000000002 44 24.025 25.2 27.075 23.7 45 23.7 26.575 25.674999999999997 24.05 46 22.900000000000002 27.200000000000003 25.1 24.8 47 23.625 26.8 25.5 24.075 48 22.825 27.275 25.75 24.15 49 22.35 26.1 26.474999999999998 25.074999999999996 50 23.825 26.674999999999997 26.6 22.900000000000002 51 23.575 25.900000000000002 26.400000000000002 24.125 52 24.275 26.8 25.775 23.150000000000002 53 24.15 26.775 25.324999999999996 23.75 54 23.925 25.825 26.424999999999997 23.825 55 23.425 25.724999999999998 26.875 23.974999999999998 56 23.175 27.1 26.325 23.400000000000002 57 24.0 26.825 26.674999999999997 22.5 58 24.325 27.05 24.75 23.875 59 24.025 27.125 25.6 23.25 60 24.3 26.224999999999998 27.125 22.35 61 23.150000000000002 25.924999999999997 27.625 23.3 62 23.325000000000003 25.724999999999998 27.575 23.375 63 24.25 25.324999999999996 26.400000000000002 24.025 64 23.674999999999997 27.900000000000002 25.924999999999997 22.5 65 23.875 26.05 26.125 23.95 66 25.324999999999996 27.05 24.05 23.575 67 24.25 28.199999999999996 24.9 22.650000000000002 68 24.25 26.150000000000002 25.525 24.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 3.5 22 5.0 23 4.5 24 6.5 25 9.0 26 9.5 27 18.0 28 26.0 29 29.0 30 33.0 31 34.0 32 36.0 33 59.0 34 80.0 35 95.0 36 118.5 37 127.0 38 143.5 39 176.0 40 218.5 41 245.0 42 247.5 43 276.0 44 302.0 45 306.0 46 296.5 47 283.0 48 279.0 49 266.0 50 257.0 51 244.0 52 191.5 53 152.0 54 147.5 55 137.0 56 131.0 57 127.0 58 97.0 59 71.0 60 71.0 61 64.5 62 58.0 63 43.0 64 30.5 65 29.5 66 26.0 67 25.5 68 26.5 69 28.0 70 28.0 71 24.0 72 20.0 73 26.0 74 23.5 75 15.0 76 12.5 77 10.5 78 11.0 79 9.0 80 4.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.53452349698084 91.925 2 2.5728537673930165 4.9 3 0.5513258072985036 1.575 4 0.15752165922814387 0.6 5 0.10501443948542925 0.5 6 0.05250721974271463 0.3 7 0.0 0.0 8 0.026253609871357313 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAA 8 0.2 TruSeq Adapter, Index 2 (100% over 63bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAA 6 0.15 TruSeq Adapter, Index 2 (100% over 63bp) GAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAA 6 0.15 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 5 0.125 No Hit GTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCCCGCAGCGATACTGACGTG 5 0.125 No Hit CACGTATTAGCTCTAGAATTACTACGGTTATCCGAGTAGCAAATACCATCAAACAAACTATAACTGAT 5 0.125 No Hit CACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.275 0.0 0.0 0.0 0.0 2 0.275 0.0 0.0 0.0 0.0 3 0.275 0.0 0.0 0.0 0.0 4 0.275 0.0 0.0 0.0 0.0 5 0.275 0.0 0.0 0.0 0.0 6 0.275 0.0 0.0 0.0 0.0 7 0.275 0.0 0.0 0.0 0.0 8 0.275 0.0 0.0 0.0 0.0 9 0.275 0.0 0.0 0.0 0.0 10 0.275 0.0 0.0 0.0 0.0 11 0.275 0.0 0.0 0.0 0.0 12 0.275 0.0 0.0 0.0 0.0 13 0.275 0.0 0.0 0.0 0.0 14 0.275 0.0 0.0 0.0 0.0 15 0.275 0.0 0.0 0.0 0.0 16 0.275 0.0 0.0 0.0 0.0 17 0.275 0.0 0.0 0.0 0.0 18 0.275 0.0 0.0 0.0 0.0 19 0.275 0.0 0.0 0.0 0.0 20 0.275 0.0 0.0 0.0 0.0 21 0.275 0.0 0.0 0.0 0.0 22 0.275 0.0 0.0 0.0 0.0 23 0.275 0.0 0.0 0.0 0.0 24 0.275 0.0 0.0 0.0 0.0 25 0.275 0.0 0.0 0.0 0.0 26 0.275 0.0 0.0 0.0 0.0 27 0.275 0.0 0.0 0.0 0.0 28 0.275 0.0 0.0 0.0 0.0 29 0.275 0.0 0.0 0.0 0.0 30 0.275 0.0 0.0 0.0 0.0 31 0.275 0.0 0.0 0.0 0.0 32 0.275 0.0 0.0 0.0 0.0 33 0.275 0.0 0.0 0.0 0.0 34 0.275 0.0 0.0 0.0 0.0 35 0.275 0.0 0.0 0.0 0.0 36 0.275 0.0 0.0 0.0 0.0 37 0.275 0.0 0.0 0.0 0.0 38 0.275 0.0 0.0 0.0 0.0 39 0.275 0.0 0.0 0.0 0.0 40 0.275 0.0 0.0 0.0 0.0 41 0.275 0.0 0.0 0.0 0.0 42 0.275 0.0 0.0 0.0 0.0 43 0.275 0.0 0.0 0.0 0.0 44 0.275 0.0 0.0 0.0 0.0 45 0.275 0.0 0.0 0.0 0.0 46 0.275 0.0 0.0 0.0 0.0 47 0.275 0.0 0.0 0.0 0.0 48 0.275 0.0 0.0 0.0 0.0 49 0.275 0.0 0.0 0.0 0.0 50 0.275 0.0 0.0 0.0 0.0 51 0.275 0.0 0.0 0.0 0.0 52 0.275 0.0 0.0 0.0 0.0 53 0.275 0.0 0.0 0.0 0.0 54 0.275 0.0 0.0 0.0 0.0 55 0.275 0.0 0.0 0.0 0.0 56 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139988 spots for SRR3207725.sra Written 139988 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra Read 139970 spots for SRR3207725.sra Written 139970 spots for SRR3207725.sra SRR ids: ['SRR3207725.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__9s7pv86 SRR3207725.sra spots: 2799418 blocks: [[1, 139970], [139971, 279940], [279941, 419910], [419911, 559880], [559881, 699850], [699851, 839820], [839821, 979790], [979791, 1119760], [1119761, 1259730], [1259731, 1399700], [1399701, 1539670], [1539671, 1679640], [1679641, 1819610], [1819611, 1959580], [1959581, 2099550], [2099551, 2239520], [2239521, 2379490], [2379491, 2519460], [2519461, 2659430], [2659431, 2799418]] SRR3207725 file size 587174 SRR3207725 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207725 SRR3207725_1.fastq Input file: SRR3207725_1.fastq trimmed: SRR3207725-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:42:29 2025 >> started Mon Feb 10 16:42:36 2025 >> done (6.183s) 2799418 reads processed; of these: 5805 ( 0.21%) short reads filtered out after trimming by size control 25816 ( 0.92%) empty reads filtered out after trimming by size control 2767797 (98.87%) reads available; of these: 506250 (18.29%) trimmed reads available after processing 2261547 (81.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1030 0.04% 19 1869 0.07% 20 3414 0.12% 21 1120 0.04% 22 1683 0.06% 23 2763 0.10% 24 4935 0.18% 25 8725 0.32% 26 1796 0.06% 27 2652 0.10% 28 3492 0.13% 29 5794 0.21% 30 8441 0.30% 31 2227 0.08% 32 3362 0.12% 33 3392 0.12% 34 5827 0.21% 35 9605 0.35% 36 2918 0.11% 37 3315 0.12% 38 5467 0.20% 39 9474 0.34% 40 14841 0.54% 41 3621 0.13% 42 4829 0.17% 43 7023 0.25% 44 10965 0.40% 45 18493 0.67% 46 4612 0.17% 47 5987 0.22% 48 9053 0.33% 49 14055 0.51% 50 22889 0.83% 51 5814 0.21% 52 7294 0.26% 53 10211 0.37% 54 17814 0.64% 55 27673 1.00% 56 6872 0.25% 57 8859 0.32% 58 13557 0.49% 59 21874 0.79% 60 38480 1.39% 61 8746 0.32% 62 11684 0.42% 63 16847 0.61% 64 26932 0.97% 65 42565 1.54% 66 10312 0.37% 67 21047 0.76% 68 2261547 81.71% 2767797 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=22 prefix-density=0.44 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=15.33 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=1.9 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC Started job on | Feb 10 16:42:54 Started mapping on | Feb 10 16:42:58 Finished on | Feb 10 16:43:04 Mapping speed, Million of reads per hour | 1660.68 Number of input reads | 2767797 Average input read length | 64 UNIQUE READS: Uniquely mapped reads number | 1653314 Uniquely mapped reads % | 59.73% Average mapped length | 66.49 Number of splices: Total | 302445 Number of splices: Annotated (sjdb) | 297345 Number of splices: GT/AG | 297989 Number of splices: GC/AG | 3614 Number of splices: AT/AC | 323 Number of splices: Non-canonical | 519 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 74149 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 1008160 % of reads mapped to too many loci | 36.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1040334 1040334 1040334 N_multimapping 74149 74149 74149 N_noFeature 112143 874174 879427 N_ambiguous 17044 2583 2620 UnstrandedReadsAssigned:1524127 PositiveStrandReadsAssigned:776557 NegativeStrandReadsAssigned:771267 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207725 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207725-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,767,797 reads, 2,402,263 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR3207725.ke.tsv 34699 SRR3207725.se.tsv 87100 total ==> SRR3207725.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 48 13.3478 Potri.005G024800.1.v4.1 1035 936 10 5.70121 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 28.3029 5.31061 Potri.016G087400.1.v4.1 270 171 51 159.154 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 5 1.59389 Potri.012G127500.1.v4.1 977 878 132 80.2273 ==> SRR3207725.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 159 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 29 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207725 completed mapping pipeline successfully