Starting /dee2/code/volunteer_pipeline.sh SRR3207726 current disk space = 3058230140928 free memory = 1041142968 SRR3207726 SRAfilesize 600d4ec290ead32a3973c08245a55cc0 SRR3207726.sra SRR3207726.sra file validated SRR3207726 is single end SRR3207726 is conventional basespace SRR3207726 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207726_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.613 39.0 38.0 40.0 35.0 40.0 2 37.414 39.0 38.0 40.0 33.0 40.0 3 37.33225 39.0 38.0 40.0 33.0 40.0 4 37.28025 39.0 38.0 40.0 33.0 40.0 5 37.31975 39.0 38.0 40.0 33.0 40.0 6 37.2815 39.0 37.0 40.0 33.0 40.0 7 37.436 39.0 38.0 40.0 33.0 40.0 8 37.311 39.0 37.0 40.0 33.0 40.0 9 37.23025 39.0 37.0 40.0 33.0 40.0 10 37.16925 39.0 37.0 40.0 33.0 40.0 11 37.49325 39.0 38.0 40.0 33.0 40.0 12 37.26525 39.0 36.0 40.0 33.0 40.0 13 37.2255 39.0 36.0 40.0 33.0 40.0 14 37.29375 39.0 37.0 40.0 33.0 40.0 15 37.2945 39.0 36.0 40.0 33.0 40.0 16 37.28125 39.0 36.0 40.0 33.0 40.0 17 37.1135 39.0 36.0 40.0 33.0 40.0 18 37.06675 39.0 36.0 40.0 32.0 40.0 19 37.034 39.0 36.0 40.0 32.0 40.0 20 36.9185 38.0 36.0 40.0 32.0 40.0 21 36.96975 39.0 36.0 40.0 33.0 40.0 22 36.82275 38.0 36.0 40.0 31.0 40.0 23 36.695 38.0 35.0 40.0 31.0 40.0 24 36.696 38.0 36.0 40.0 31.0 40.0 25 36.51225 38.0 35.0 40.0 31.0 40.0 26 36.37 38.0 35.0 40.0 31.0 40.0 27 36.266 38.0 35.0 40.0 31.0 40.0 28 36.1805 38.0 35.0 39.0 30.0 40.0 29 35.96575 38.0 35.0 39.0 30.0 40.0 30 35.94225 38.0 35.0 39.0 29.0 40.0 31 36.167 38.0 35.0 40.0 30.0 40.0 32 36.12325 38.0 35.0 40.0 30.0 40.0 33 36.1175 38.0 35.0 40.0 30.0 40.0 34 36.03375 38.0 35.0 40.0 30.0 40.0 35 35.96775 38.0 35.0 40.0 30.0 40.0 36 36.442 39.0 36.0 40.0 31.0 40.0 37 36.20475 38.0 35.0 39.0 31.0 40.0 38 36.05925 38.0 35.0 40.0 30.0 40.0 39 36.1075 38.0 35.0 39.0 31.0 40.0 40 35.989 38.0 35.0 39.0 30.0 40.0 41 35.8735 38.0 35.0 39.0 30.0 40.0 42 35.73225 38.0 35.0 39.0 30.0 40.0 43 35.66825 38.0 35.0 39.0 29.0 40.0 44 35.49325 38.0 35.0 39.0 29.0 40.0 45 35.302 38.0 35.0 39.0 29.0 40.0 46 35.199 38.0 34.0 39.0 29.0 40.0 47 35.09825 38.0 34.0 39.0 28.0 40.0 48 34.97425 38.0 33.0 39.0 29.0 40.0 49 34.80825 38.0 33.0 39.0 28.0 40.0 50 34.5885 37.0 33.0 39.0 27.0 40.0 51 34.5335 38.0 33.0 39.0 28.0 40.0 52 34.2595 37.0 33.0 39.0 27.0 40.0 53 33.89375 36.0 33.0 39.0 26.0 40.0 54 33.81175 36.0 33.0 39.0 27.0 40.0 55 33.765 36.0 33.0 39.0 26.0 40.0 56 33.35175 36.0 33.0 39.0 23.0 40.0 57 32.9615 36.0 32.0 39.0 23.0 40.0 58 32.91875 36.0 32.0 39.0 23.0 40.0 59 32.75325 36.0 32.0 39.0 22.0 39.0 60 32.443 36.0 32.0 39.0 21.0 39.0 61 31.744 36.0 31.0 38.0 15.0 39.0 62 31.6105 35.0 31.0 38.0 15.0 39.0 63 31.3615 35.0 31.0 38.0 14.0 39.0 64 31.07525 35.0 31.0 38.0 2.0 39.0 65 30.81175 35.0 30.0 38.0 2.0 39.0 66 30.35225 35.0 30.0 38.0 2.0 39.0 67 30.246 35.0 30.0 38.0 2.0 39.0 68 29.34575 33.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 2.0 9 2.0 10 4.0 11 4.0 12 4.0 13 4.0 14 5.0 15 9.0 16 7.0 17 12.0 18 8.0 19 15.0 20 10.0 21 23.0 22 14.0 23 33.0 24 30.0 25 39.0 26 51.0 27 53.0 28 58.0 29 61.0 30 83.0 31 93.0 32 111.0 33 195.0 34 268.0 35 315.0 36 477.0 37 611.0 38 772.0 39 618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.447428426653154 13.985305295160883 20.623258170762604 42.94400810742336 2 18.625 25.575 35.175 20.625 3 23.95 28.499999999999996 25.025 22.525000000000002 4 24.474999999999998 33.800000000000004 19.2 22.525000000000002 5 24.349999999999998 36.825 21.825 17.0 6 18.5 36.875 25.55 19.075 7 16.1 15.7 46.050000000000004 22.15 8 19.3 22.95 28.799999999999997 28.95 9 20.0 23.175 32.1 24.725 10 19.0 40.575 23.200000000000003 17.224999999999998 11 25.525 28.199999999999996 19.8 26.474999999999998 12 21.349999999999998 24.325 28.725 25.6 13 18.8 29.25 30.475 21.475 14 19.575 28.000000000000004 29.25 23.175 15 21.425 28.075 27.075 23.425 16 21.65 27.875 28.175 22.3 17 22.625 27.950000000000003 26.375 23.05 18 22.1 28.199999999999996 27.375 22.325 19 21.65 28.625 27.500000000000004 22.225 20 21.75 28.050000000000004 27.55 22.650000000000002 21 21.575 28.7 27.35 22.375 22 21.475 28.95 26.900000000000002 22.675 23 22.35 28.549999999999997 27.224999999999998 21.875 24 21.0 29.075 27.425 22.5 25 20.925 28.65 27.85 22.575 26 21.099999999999998 29.4 27.375 22.125 27 21.349999999999998 28.9 27.200000000000003 22.55 28 21.65 28.075 28.95 21.325 29 21.075 29.075 28.325 21.525 30 20.525 29.45 27.175 22.85 31 21.099999999999998 28.349999999999998 28.475 22.075 32 21.7 27.450000000000003 27.500000000000004 23.35 33 21.349999999999998 29.7 27.250000000000004 21.7 34 21.5 27.85 28.075 22.575 35 21.099999999999998 28.625 28.15 22.125 36 21.45 28.449999999999996 27.700000000000003 22.400000000000002 37 20.65 29.125 27.650000000000002 22.575 38 20.575 28.799999999999997 27.0 23.625 39 21.7 27.175 28.125 23.0 40 20.349999999999998 29.099999999999998 27.825 22.725 41 21.15 28.849999999999998 28.299999999999997 21.7 42 20.875 27.375 29.349999999999998 22.400000000000002 43 21.8 28.125 28.000000000000004 22.075 44 22.175 27.400000000000002 27.05 23.375 45 21.4 29.7 27.400000000000002 21.5 46 21.45 27.85 28.475 22.225 47 21.475 28.675 28.175 21.675 48 21.0 28.375 28.599999999999998 22.025 49 22.575 28.749999999999996 25.674999999999997 23.0 50 21.875 27.650000000000002 29.125 21.349999999999998 51 21.475 27.1 27.650000000000002 23.775 52 21.925 27.3 28.025 22.75 53 22.625 28.475 27.125 21.775 54 21.275 29.099999999999998 26.525 23.1 55 22.0 27.650000000000002 28.199999999999996 22.15 56 21.349999999999998 28.175 28.4 22.075 57 21.825 27.075 28.925 22.175 58 21.75 26.35 29.625 22.275 59 21.95 28.875 28.1 21.075 60 21.175 28.65 28.625 21.55 61 21.475 27.750000000000004 30.025000000000002 20.75 62 22.0 28.95 26.775 22.275 63 22.400000000000002 26.400000000000002 29.275000000000002 21.925 64 22.125 28.65 26.424999999999997 22.8 65 20.925 30.625000000000004 27.0 21.45 66 21.975 30.225 26.85 20.95 67 22.375 26.85 29.349999999999998 21.425 68 20.925 28.95 29.225 20.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.5 19 4.0 20 3.5 21 4.0 22 5.0 23 6.0 24 8.0 25 9.0 26 14.5 27 22.5 28 25.0 29 34.5 30 49.5 31 55.0 32 75.0 33 99.0 34 103.0 35 123.5 36 151.0 37 158.0 38 202.0 39 264.5 40 277.0 41 271.0 42 299.5 43 344.0 44 360.0 45 373.0 46 347.0 47 308.0 48 302.0 49 257.5 50 219.0 51 208.5 52 168.0 53 138.0 54 119.0 55 84.0 56 68.0 57 56.0 58 36.5 59 29.0 60 18.5 61 12.0 62 16.0 63 11.0 64 5.0 65 3.5 66 3.0 67 2.5 68 2.0 69 2.0 70 3.0 71 2.0 72 0.0 73 0.5 74 1.0 75 1.0 76 1.5 77 1.5 78 1.0 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82456140350877 99.575 2 0.15037593984962408 0.3 3 0.0 0.0 4 0.0 0.0 5 0.02506265664160401 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.15 0.0 0.0 0.0 0.0 23 0.15 0.0 0.0 0.0 0.0 24 0.15 0.0 0.0 0.0 0.0 25 0.15 0.0 0.0 0.0 0.0 26 0.15 0.0 0.0 0.0 0.0 27 0.15 0.0 0.0 0.0 0.0 28 0.15 0.0 0.0 0.0 0.0 29 0.15 0.0 0.0 0.0 0.0 30 0.15 0.0 0.0 0.0 0.0 31 0.15 0.0 0.0 0.0 0.0 32 0.15 0.0 0.0 0.0 0.0 33 0.15 0.0 0.0 0.0 0.0 34 0.175 0.0 0.0 0.0 0.0 35 0.175 0.0 0.0 0.0 0.0 36 0.175 0.0 0.0 0.0 0.0 37 0.175 0.0 0.0 0.0 0.0 38 0.175 0.0 0.0 0.0 0.0 39 0.175 0.0 0.0 0.0 0.0 40 0.175 0.0 0.0 0.0 0.0 41 0.175 0.0 0.0 0.0 0.0 42 0.175 0.0 0.0 0.0 0.0 43 0.175 0.0 0.0 0.0 0.0 44 0.175 0.0 0.0 0.0 0.0 45 0.175 0.0 0.0 0.0 0.0 46 0.175 0.0 0.0 0.0 0.0 47 0.175 0.0 0.0 0.0 0.0 48 0.2 0.0 0.0 0.0 0.0 49 0.2 0.0 0.0 0.0 0.0 50 0.2 0.0 0.0 0.0 0.0 51 0.2 0.0 0.0 0.0 0.0 52 0.2 0.0 0.0 0.0 0.0 53 0.2 0.0 0.0 0.0 0.0 54 0.2 0.0 0.0 0.0 0.0 55 0.2 0.0 0.0 0.0 0.0 56 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra Read 258439 spots for SRR3207726.sra Written 258439 spots for SRR3207726.sra SRR ids: ['SRR3207726.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pe1jm13a SRR3207726.sra spots: 5168780 blocks: [[1, 258439], [258440, 516878], [516879, 775317], [775318, 1033756], [1033757, 1292195], [1292196, 1550634], [1550635, 1809073], [1809074, 2067512], [2067513, 2325951], [2325952, 2584390], [2584391, 2842829], [2842830, 3101268], [3101269, 3359707], [3359708, 3618146], [3618147, 3876585], [3876586, 4135024], [4135025, 4393463], [4393464, 4651902], [4651903, 4910341], [4910342, 5168780]] SRR3207726 file size 1085050 SRR3207726 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207726 SRR3207726_1.fastq Input file: SRR3207726_1.fastq trimmed: SRR3207726-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:57:42 2025 >> started Mon Feb 10 16:57:44 2025 >> done (2.444s) 5168780 reads processed; of these: 6499 ( 0.13%) short reads filtered out after trimming by size control 15638 ( 0.30%) empty reads filtered out after trimming by size control 5146643 (99.57%) reads available; of these: 533818 (10.37%) trimmed reads available after processing 4612825 (89.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 850 0.02% 19 1621 0.03% 20 3552 0.07% 21 985 0.02% 22 1418 0.03% 23 2131 0.04% 24 3738 0.07% 25 6820 0.13% 26 1590 0.03% 27 2196 0.04% 28 2858 0.06% 29 4377 0.09% 30 6900 0.13% 31 1983 0.04% 32 2636 0.05% 33 2824 0.05% 34 4604 0.09% 35 7647 0.15% 36 2199 0.04% 37 2889 0.06% 38 4156 0.08% 39 7064 0.14% 40 11466 0.22% 41 2798 0.05% 42 3809 0.07% 43 5763 0.11% 44 9424 0.18% 45 15669 0.30% 46 4028 0.08% 47 5205 0.10% 48 7901 0.15% 49 13286 0.26% 50 22141 0.43% 51 5493 0.11% 52 7001 0.14% 53 10354 0.20% 54 17883 0.35% 55 30219 0.59% 56 7092 0.14% 57 9693 0.19% 58 14700 0.29% 59 25403 0.49% 60 46368 0.90% 61 9817 0.19% 62 13257 0.26% 63 20490 0.40% 64 34528 0.67% 65 57884 1.12% 66 14273 0.28% 67 32835 0.64% 68 4612825 89.63% 5146643 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=171.46 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=20.5 sequence=TTCTTCTTCTTT Started job on | Feb 10 16:58:03 Started mapping on | Feb 10 16:58:03 Finished on | Feb 10 16:58:08 Mapping speed, Million of reads per hour | 3705.58 Number of input reads | 5146643 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4861484 Uniquely mapped reads % | 94.46% Average mapped length | 66.53 Number of splices: Total | 919463 Number of splices: Annotated (sjdb) | 904590 Number of splices: GT/AG | 906163 Number of splices: GC/AG | 11059 Number of splices: AT/AC | 956 Number of splices: Non-canonical | 1285 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 165180 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 93509 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 119979 119979 119979 N_multimapping 165180 165180 165180 N_noFeature 220838 2525452 2524423 N_ambiguous 47279 7308 7575 UnstrandedReadsAssigned:4593367 PositiveStrandReadsAssigned:2328724 NegativeStrandReadsAssigned:2329486 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207726 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207726-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,146,643 reads, 4,763,664 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR3207726.ke.tsv 34699 SRR3207726.se.tsv 87100 total ==> SRR3207726.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 118 19.345 Potri.005G024800.1.v4.1 1035 936 16 5.37781 Potri.004G059700.1.v4.1 961 862 3 1.0949 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 89.0161 9.84692 Potri.016G087400.1.v4.1 270 171 202 371.635 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23 4.32249 Potri.012G127500.1.v4.1 977 878 373 133.652 ==> SRR3207726.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 396 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 79 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207726 completed mapping pipeline successfully