Starting /dee2/code/volunteer_pipeline.sh SRR3207727 current disk space = 3058075148288 free memory = 1418607616 SRR3207727 SRAfilesize c0e64e35d296bb4aeaa183bc452c9a2f SRR3207727.sra SRR3207727.sra file validated SRR3207727 is single end SRR3207727 is conventional basespace SRR3207727 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207727_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.9185 39.0 38.0 40.0 33.0 40.0 2 36.873 39.0 37.0 40.0 33.0 40.0 3 36.8325 39.0 37.0 40.0 32.0 40.0 4 36.81275 39.0 37.0 40.0 32.0 40.0 5 36.80625 39.0 37.0 40.0 32.0 40.0 6 36.8755 39.0 37.0 40.0 33.0 40.0 7 37.03225 39.0 37.0 40.0 33.0 40.0 8 36.88175 39.0 37.0 40.0 32.0 40.0 9 36.7985 39.0 36.0 40.0 32.0 40.0 10 36.904 39.0 37.0 40.0 33.0 40.0 11 37.21375 39.0 36.0 40.0 33.0 40.0 12 37.008 39.0 36.0 40.0 32.0 40.0 13 37.0065 39.0 36.0 40.0 31.0 40.0 14 36.988 39.0 36.0 40.0 31.0 40.0 15 36.968 39.0 36.0 40.0 31.0 40.0 16 36.84575 39.0 36.0 40.0 32.0 40.0 17 36.67725 39.0 36.0 40.0 31.0 40.0 18 36.7185 38.0 36.0 40.0 31.0 40.0 19 36.60375 38.0 35.0 40.0 31.0 40.0 20 36.57 38.0 35.0 40.0 31.0 40.0 21 36.60175 38.0 36.0 40.0 31.0 40.0 22 36.47225 38.0 35.0 40.0 31.0 40.0 23 36.43475 38.0 35.0 40.0 31.0 40.0 24 36.322 38.0 35.0 40.0 31.0 40.0 25 36.25875 38.0 35.0 40.0 30.0 40.0 26 36.10625 38.0 35.0 39.0 30.0 40.0 27 35.72475 38.0 35.0 39.0 29.0 40.0 28 35.6135 38.0 35.0 39.0 29.0 40.0 29 35.40775 38.0 34.0 39.0 29.0 40.0 30 35.38025 38.0 34.0 39.0 28.0 40.0 31 35.81925 38.0 35.0 39.0 30.0 40.0 32 35.72075 38.0 35.0 39.0 29.0 40.0 33 35.65175 38.0 35.0 39.0 29.0 40.0 34 35.60825 38.0 35.0 39.0 30.0 40.0 35 35.4175 38.0 35.0 39.0 29.0 40.0 36 35.882 38.0 35.0 39.0 30.0 40.0 37 35.656 38.0 35.0 39.0 29.0 40.0 38 35.47275 38.0 35.0 39.0 29.0 40.0 39 35.514 38.0 35.0 39.0 29.0 40.0 40 35.30575 38.0 35.0 39.0 29.0 40.0 41 35.127 38.0 35.0 39.0 29.0 40.0 42 34.934 38.0 34.0 39.0 27.0 40.0 43 35.019 38.0 34.0 39.0 29.0 40.0 44 34.82 38.0 34.0 39.0 28.0 40.0 45 34.537 38.0 33.0 39.0 27.0 40.0 46 34.325 38.0 33.0 39.0 26.0 40.0 47 34.27775 37.0 33.0 39.0 27.0 40.0 48 33.99425 37.0 33.0 39.0 25.0 40.0 49 33.906 37.0 33.0 39.0 25.0 40.0 50 33.618 36.0 33.0 39.0 25.0 40.0 51 33.4985 36.0 33.0 39.0 24.0 40.0 52 33.1865 36.0 32.0 39.0 23.0 40.0 53 32.93875 36.0 32.0 39.0 23.0 40.0 54 32.89475 36.0 32.0 39.0 23.0 39.0 55 32.81225 36.0 32.0 39.0 23.0 40.0 56 32.45925 36.0 32.0 39.0 21.0 39.0 57 32.09575 35.0 31.0 38.0 20.0 39.0 58 32.09875 35.0 31.0 38.0 20.0 39.0 59 31.87425 35.0 31.0 38.0 18.0 39.0 60 31.476 35.0 31.0 38.0 15.0 39.0 61 30.6735 35.0 30.0 38.0 2.0 39.0 62 30.74425 35.0 30.0 38.0 2.0 39.0 63 30.29125 34.0 30.0 38.0 2.0 39.0 64 30.2615 34.0 30.0 38.0 2.0 39.0 65 29.962 34.0 29.0 37.0 2.0 39.0 66 29.43925 34.0 29.0 37.0 2.0 39.0 67 29.4215 34.0 29.0 37.0 2.0 39.0 68 28.40225 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 4.0 9 3.0 10 4.0 11 7.0 12 7.0 13 11.0 14 7.0 15 16.0 16 14.0 17 15.0 18 10.0 19 15.0 20 23.0 21 12.0 22 28.0 23 32.0 24 36.0 25 36.0 26 42.0 27 68.0 28 80.0 29 81.0 30 93.0 31 109.0 32 127.0 33 172.0 34 247.0 35 337.0 36 467.0 37 632.0 38 716.0 39 524.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.430701979943432 14.913859604011314 17.793777320647983 41.861661095397274 2 18.525 25.2 38.025 18.25 3 22.975 28.000000000000004 26.55 22.475 4 24.775 34.25 20.200000000000003 20.775 5 24.6 33.75 24.325 17.325 6 18.25 36.975 24.4 20.375 7 15.925 16.225 45.4 22.45 8 18.2 22.650000000000002 30.025000000000002 29.125 9 19.85 24.4 30.275000000000002 25.474999999999998 10 20.075000000000003 38.85 23.400000000000002 17.675 11 26.25 28.075 21.2 24.474999999999998 12 20.925 24.425 29.075 25.575 13 19.625 27.775 31.674999999999997 20.925 14 20.599999999999998 28.749999999999996 29.65 21.0 15 21.725 27.800000000000004 28.175 22.3 16 21.6 28.075 27.85 22.475 17 22.875 27.6 26.474999999999998 23.05 18 20.625 29.849999999999998 27.450000000000003 22.075 19 20.75 28.325 28.525 22.400000000000002 20 22.575 27.750000000000004 27.500000000000004 22.175 21 20.5 28.025 28.95 22.525000000000002 22 21.925 29.325000000000003 28.225 20.525 23 21.525 29.175 26.950000000000003 22.35 24 21.475 28.325 27.525 22.675 25 20.225 29.425 28.525 21.825 26 21.525 28.775000000000002 27.825 21.875 27 21.525 29.15 27.075 22.25 28 21.5 29.025000000000002 28.625 20.849999999999998 29 20.825 28.925 28.125 22.125 30 19.975 28.499999999999996 28.599999999999998 22.925 31 20.575 28.375 28.249999999999996 22.8 32 20.925 28.549999999999997 27.425 23.1 33 21.575 28.449999999999996 28.125 21.85 34 21.625 28.549999999999997 27.85 21.975 35 22.725 28.375 26.0 22.900000000000002 36 21.6 29.925 27.950000000000003 20.525 37 22.425 28.1 26.75 22.725 38 21.575 29.349999999999998 27.975 21.099999999999998 39 21.75 27.975 27.575 22.7 40 21.775 28.249999999999996 27.525 22.45 41 22.225 27.1 29.025000000000002 21.65 42 22.425 28.275 27.450000000000003 21.85 43 22.25 27.025 28.825 21.9 44 22.05 27.925 27.975 22.05 45 20.974999999999998 29.475 27.275 22.275 46 21.45 28.775000000000002 28.349999999999998 21.425 47 23.65 28.349999999999998 27.325 20.674999999999997 48 21.475 27.950000000000003 28.95 21.625 49 21.875 28.275 27.175 22.675 50 21.775 28.625 28.299999999999997 21.3 51 22.125 29.475 27.375 21.025 52 22.975 28.675 27.950000000000003 20.4 53 21.325 29.799999999999997 26.825 22.05 54 22.075 27.925 28.15 21.85 55 21.55 27.025 30.025000000000002 21.4 56 23.150000000000002 27.900000000000002 28.425 20.525 57 21.55 27.725 27.1 23.625 58 21.325 28.4 29.025000000000002 21.25 59 22.2 28.925 27.900000000000002 20.974999999999998 60 21.475 28.575 27.975 21.975 61 20.7 27.675 28.575 23.05 62 22.675 27.675 26.825 22.825 63 21.725 28.349999999999998 27.6 22.325 64 21.775 28.15 28.175 21.9 65 22.1 28.799999999999997 27.525 21.575 66 20.599999999999998 28.599999999999998 29.575000000000003 21.224999999999998 67 22.525000000000002 27.775 27.650000000000002 22.05 68 23.1 28.125 27.3 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 3.5 21 4.5 22 4.0 23 5.0 24 9.5 25 13.0 26 16.5 27 22.0 28 24.0 29 35.5 30 54.5 31 62.0 32 72.0 33 104.5 34 127.0 35 134.5 36 164.0 37 186.0 38 213.5 39 259.0 40 294.0 41 311.0 42 335.0 43 344.0 44 329.0 45 332.0 46 314.0 47 293.0 48 290.0 49 258.0 50 229.0 51 200.5 52 158.5 53 145.0 54 121.5 55 80.0 56 62.0 57 48.5 58 33.5 59 32.0 60 26.0 61 17.5 62 15.0 63 11.0 64 7.0 65 7.5 66 8.0 67 4.5 68 3.0 69 5.0 70 3.0 71 2.0 72 3.0 73 2.0 74 1.5 75 2.0 76 1.0 77 1.0 78 2.0 79 1.0 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476059 spots for SRR3207727.sra Written 476059 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra Read 476049 spots for SRR3207727.sra Written 476049 spots for SRR3207727.sra SRR ids: ['SRR3207727.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hqfl1jqn SRR3207727.sra spots: 9520990 blocks: [[1, 476049], [476050, 952098], [952099, 1428147], [1428148, 1904196], [1904197, 2380245], [2380246, 2856294], [2856295, 3332343], [3332344, 3808392], [3808393, 4284441], [4284442, 4760490], [4760491, 5236539], [5236540, 5712588], [5712589, 6188637], [6188638, 6664686], [6664687, 7140735], [7140736, 7616784], [7616785, 8092833], [8092834, 8568882], [8568883, 9044931], [9044932, 9520990]] SRR3207727 file size 1999600 SRR3207727 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207727 SRR3207727_1.fastq Input file: SRR3207727_1.fastq trimmed: SRR3207727-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:21:50 2025 >> started Mon Feb 10 17:21:55 2025 >> done (4.560s) 9520990 reads processed; of these: 11952 ( 0.13%) short reads filtered out after trimming by size control 15001 ( 0.16%) empty reads filtered out after trimming by size control 9494037 (99.72%) reads available; of these: 970567 (10.22%) trimmed reads available after processing 8523470 (89.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1779 0.02% 19 3024 0.03% 20 5330 0.06% 21 1690 0.02% 22 2572 0.03% 23 3865 0.04% 24 6733 0.07% 25 12127 0.13% 26 2877 0.03% 27 3904 0.04% 28 5216 0.05% 29 8007 0.08% 30 12575 0.13% 31 3488 0.04% 32 4668 0.05% 33 5350 0.06% 34 8312 0.09% 35 13394 0.14% 36 3891 0.04% 37 5073 0.05% 38 7574 0.08% 39 12696 0.13% 40 21022 0.22% 41 5159 0.05% 42 6804 0.07% 43 10318 0.11% 44 17303 0.18% 45 28543 0.30% 46 7154 0.08% 47 9460 0.10% 48 14272 0.15% 49 23669 0.25% 50 40863 0.43% 51 9859 0.10% 52 12766 0.13% 53 18683 0.20% 54 32731 0.34% 55 55095 0.58% 56 12786 0.13% 57 17539 0.18% 58 26594 0.28% 59 46424 0.49% 60 84790 0.89% 61 17910 0.19% 62 24221 0.26% 63 37257 0.39% 64 62948 0.66% 65 106048 1.12% 66 26223 0.28% 67 59981 0.63% 68 8523470 89.78% 9494037 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=26.95 fanout-score-rank=7 prefix-density=0.11 prefix-fanout=8.3 sequence=CACCAGCACCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=206.46 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=22.3 sequence=TTCTTCTTCTTC Started job on | Feb 10 17:22:12 Started mapping on | Feb 10 17:22:12 Finished on | Feb 10 17:22:20 Mapping speed, Million of reads per hour | 4272.32 Number of input reads | 9494037 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8987817 Uniquely mapped reads % | 94.67% Average mapped length | 66.55 Number of splices: Total | 1717036 Number of splices: Annotated (sjdb) | 1689730 Number of splices: GT/AG | 1692144 Number of splices: GC/AG | 20661 Number of splices: AT/AC | 1765 Number of splices: Non-canonical | 2466 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302579 % of reads mapped to multiple loci | 3.19% Number of reads mapped to too many loci | 159755 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 203641 203641 203641 N_multimapping 302579 302579 302579 N_noFeature 421438 4671893 4678970 N_ambiguous 85432 13359 13777 UnstrandedReadsAssigned:8480947 PositiveStrandReadsAssigned:4302565 NegativeStrandReadsAssigned:4295070 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207727 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207727-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,494,037 reads, 8,782,113 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR3207727.ke.tsv 34699 SRR3207727.se.tsv 87100 total ==> SRR3207727.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 267 23.917 Potri.005G024800.1.v4.1 1035 936 26 4.77493 Potri.004G059700.1.v4.1 961 862 5 0.997086 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 132.561 8.01225 Potri.016G087400.1.v4.1 270 171 360 361.89 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 37 3.79941 Potri.012G127500.1.v4.1 977 878 795 155.648 ==> SRR3207727.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 748 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207727 completed mapping pipeline successfully