Starting /dee2/code/volunteer_pipeline.sh SRR3207728 current disk space = 3058233831424 free memory = 1417349480 SRR3207728 SRAfilesize 26eb854c2a9a595b7d45cf11a202da84 SRR3207728.sra SRR3207728.sra file validated SRR3207728 is single end SRR3207728 is conventional basespace SRR3207728 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207728_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.732 39.0 38.0 40.0 34.0 40.0 2 37.3715 39.0 37.0 40.0 33.0 40.0 3 37.26275 39.0 37.0 40.0 33.0 40.0 4 37.35925 39.0 37.0 40.0 33.0 40.0 5 37.42225 39.0 37.0 40.0 33.0 40.0 6 37.3195 39.0 37.0 40.0 33.0 40.0 7 37.31625 39.0 37.0 40.0 33.0 40.0 8 37.3445 39.0 37.0 40.0 33.0 40.0 9 37.208 39.0 36.0 40.0 33.0 40.0 10 37.25425 39.0 36.0 40.0 33.0 40.0 11 37.18675 39.0 36.0 40.0 33.0 40.0 12 37.053 39.0 36.0 40.0 33.0 40.0 13 37.0 39.0 36.0 40.0 32.0 40.0 14 37.0425 39.0 36.0 40.0 33.0 40.0 15 36.84975 39.0 36.0 40.0 32.0 40.0 16 36.91125 38.0 36.0 40.0 32.0 40.0 17 36.78525 38.0 35.0 40.0 31.0 40.0 18 36.61625 38.0 35.0 40.0 31.0 40.0 19 36.64475 38.0 35.0 40.0 31.0 40.0 20 36.5825 38.0 35.0 40.0 31.0 40.0 21 36.56575 38.0 36.0 40.0 31.0 40.0 22 36.44975 38.0 35.0 40.0 31.0 40.0 23 36.32525 38.0 35.0 39.0 31.0 40.0 24 36.11 38.0 35.0 39.0 30.0 40.0 25 36.0635 38.0 35.0 39.0 30.0 40.0 26 35.6485 38.0 35.0 39.0 29.0 40.0 27 35.62075 38.0 35.0 39.0 29.0 40.0 28 35.34325 38.0 34.0 39.0 28.0 40.0 29 35.29325 38.0 34.0 39.0 28.0 40.0 30 35.0675 38.0 33.0 39.0 27.0 40.0 31 35.32825 38.0 35.0 39.0 29.0 40.0 32 35.193 38.0 35.0 39.0 28.0 40.0 33 35.0735 38.0 34.0 39.0 27.0 40.0 34 35.12875 38.0 34.0 39.0 28.0 40.0 35 34.98475 38.0 34.0 39.0 28.0 40.0 36 35.07875 38.0 35.0 39.0 28.0 40.0 37 34.931 38.0 34.0 39.0 27.0 40.0 38 34.76725 38.0 34.0 39.0 27.0 40.0 39 34.71325 38.0 33.0 39.0 27.0 40.0 40 34.5425 38.0 33.0 39.0 27.0 40.0 41 34.491 38.0 33.0 39.0 27.0 40.0 42 34.36 38.0 33.0 39.0 27.0 40.0 43 34.2175 38.0 33.0 39.0 26.0 40.0 44 33.952 37.0 33.0 39.0 25.0 40.0 45 33.89375 37.0 33.0 39.0 25.0 40.0 46 33.601 37.0 33.0 39.0 23.0 40.0 47 33.336 37.0 33.0 39.0 23.0 40.0 48 33.10225 36.0 33.0 39.0 23.0 40.0 49 32.70225 36.0 32.0 39.0 20.0 40.0 50 32.746 36.0 32.0 39.0 21.0 40.0 51 32.50375 36.0 32.0 39.0 16.0 40.0 52 32.2485 36.0 32.0 39.0 15.0 40.0 53 32.09825 36.0 31.0 39.0 16.0 40.0 54 31.8245 36.0 31.0 39.0 11.0 40.0 55 31.6635 36.0 31.0 39.0 10.0 40.0 56 31.375 36.0 31.0 39.0 2.0 40.0 57 30.97725 35.0 30.0 38.0 2.0 39.0 58 30.8285 35.0 30.0 38.0 2.0 39.0 59 30.5885 35.0 30.0 38.0 2.0 39.0 60 30.29675 35.0 29.0 38.0 2.0 39.0 61 30.058 35.0 29.0 38.0 2.0 39.0 62 29.6905 35.0 29.0 38.0 2.0 39.0 63 29.2895 35.0 28.0 38.0 2.0 39.0 64 29.034 34.0 28.0 38.0 2.0 39.0 65 28.71775 34.0 27.0 38.0 2.0 39.0 66 28.21375 34.0 27.0 37.0 2.0 39.0 67 27.84775 33.0 26.0 37.0 2.0 39.0 68 27.056 33.0 23.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 1.0 7 4.0 8 5.0 9 3.0 10 4.0 11 13.0 12 10.0 13 10.0 14 16.0 15 25.0 16 16.0 17 19.0 18 24.0 19 23.0 20 33.0 21 28.0 22 42.0 23 52.0 24 36.0 25 61.0 26 49.0 27 67.0 28 69.0 29 78.0 30 101.0 31 106.0 32 156.0 33 187.0 34 236.0 35 308.0 36 408.0 37 609.0 38 664.0 39 534.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.813959327140346 13.406979663570173 19.081094652272157 40.69796635701732 2 21.675 23.25 32.6 22.475 3 25.474999999999998 26.325 23.95 24.25 4 27.375 30.975 18.05 23.599999999999998 5 27.525 33.425 21.55 17.5 6 21.099999999999998 34.0 23.150000000000002 21.75 7 17.5 16.150000000000002 43.525000000000006 22.825 8 19.85 22.025 28.175 29.95 9 21.6 22.0 30.475 25.924999999999997 10 21.775 38.2 21.475 18.55 11 26.875 25.85 21.099999999999998 26.174999999999997 12 23.575 22.05 29.175 25.2 13 20.225 26.950000000000003 29.349999999999998 23.474999999999998 14 22.425 25.474999999999998 28.1 24.0 15 23.825 25.624999999999996 26.474999999999998 24.075 16 22.825 25.974999999999998 26.075 25.124999999999996 17 22.275 27.05 27.474999999999998 23.200000000000003 18 22.6 26.825 26.924999999999997 23.65 19 22.875 27.325 26.974999999999998 22.825 20 22.675 26.724999999999998 26.575 24.025 21 23.275000000000002 26.125 26.35 24.25 22 22.400000000000002 27.625 27.975 22.0 23 23.275000000000002 27.150000000000002 26.825 22.75 24 22.6 26.224999999999998 27.325 23.849999999999998 25 24.275 25.5 26.525 23.7 26 24.2 27.575 25.575 22.650000000000002 27 22.875 27.175 26.35 23.599999999999998 28 23.625 25.874999999999996 27.35 23.150000000000002 29 23.325000000000003 26.875 26.1 23.7 30 24.375 24.65 27.075 23.9 31 22.5 25.525 26.924999999999997 25.05 32 24.175 26.924999999999997 25.974999999999998 22.925 33 23.05 27.025 27.400000000000002 22.525000000000002 34 22.375 27.875 26.025 23.724999999999998 35 23.549999999999997 27.275 26.0 23.175 36 22.900000000000002 27.35 26.3 23.45 37 24.0 26.724999999999998 26.424999999999997 22.85 38 23.575 27.474999999999998 26.125 22.825 39 23.275000000000002 26.474999999999998 27.075 23.175 40 23.674999999999997 26.525 26.325 23.474999999999998 41 24.625 27.1 26.025 22.25 42 23.35 27.400000000000002 26.275 22.975 43 23.325000000000003 26.575 27.575 22.525000000000002 44 22.875 27.175 26.525 23.425 45 22.475 27.650000000000002 26.424999999999997 23.45 46 24.375 26.05 26.3 23.275000000000002 47 23.875 26.3 26.35 23.474999999999998 48 22.675 27.250000000000004 26.075 24.0 49 22.95 26.950000000000003 26.275 23.825 50 23.175 26.35 25.95 24.525 51 22.475 28.075 27.125 22.325 52 23.825 25.474999999999998 26.3 24.4 53 24.05 26.875 25.7 23.375 54 24.125 27.125 26.55 22.2 55 23.575 26.6 26.1 23.724999999999998 56 23.200000000000003 26.700000000000003 27.0 23.1 57 24.125 26.85 25.424999999999997 23.599999999999998 58 23.150000000000002 26.3 26.150000000000002 24.4 59 24.0 26.700000000000003 26.900000000000002 22.400000000000002 60 23.225 26.325 26.474999999999998 23.974999999999998 61 23.599999999999998 26.900000000000002 26.5 23.0 62 23.375 27.625 26.174999999999997 22.825 63 23.849999999999998 25.85 27.250000000000004 23.05 64 24.275 27.075 26.075 22.575 65 23.375 27.925 24.7 24.0 66 23.375 27.450000000000003 25.900000000000002 23.275000000000002 67 22.5 27.650000000000002 26.525 23.325000000000003 68 23.7 26.525 27.275 22.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 3.5 22 4.0 23 5.0 24 9.5 25 13.0 26 16.0 27 25.5 28 32.0 29 30.0 30 34.5 31 41.0 32 44.0 33 67.0 34 87.0 35 103.0 36 134.0 37 149.0 38 156.0 39 174.5 40 216.5 41 247.0 42 259.5 43 294.5 44 317.0 45 315.5 46 297.0 47 280.0 48 270.0 49 249.5 50 239.0 51 230.5 52 188.0 53 154.0 54 146.5 55 132.0 56 125.0 57 112.5 58 83.5 59 67.0 60 76.0 61 67.0 62 49.0 63 43.0 64 27.0 65 16.5 66 16.0 67 24.5 68 27.0 69 21.0 70 21.5 71 23.0 72 24.0 73 22.0 74 16.5 75 13.0 76 11.0 77 9.0 78 9.0 79 8.5 80 5.0 81 2.0 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 96.92788336370737 93.075 2 2.2910700338453527 4.3999999999999995 3 0.5467326217130956 1.575 4 0.18224420723769852 0.7000000000000001 5 0.0520697734964853 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 2 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145212 spots for SRR3207728.sra Written 145212 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra Read 145205 spots for SRR3207728.sra Written 145205 spots for SRR3207728.sra SRR ids: ['SRR3207728.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3jvcbwd9 SRR3207728.sra spots: 2904107 blocks: [[1, 145205], [145206, 290410], [290411, 435615], [435616, 580820], [580821, 726025], [726026, 871230], [871231, 1016435], [1016436, 1161640], [1161641, 1306845], [1306846, 1452050], [1452051, 1597255], [1597256, 1742460], [1742461, 1887665], [1887666, 2032870], [2032871, 2178075], [2178076, 2323280], [2323281, 2468485], [2468486, 2613690], [2613691, 2758895], [2758896, 2904107]] SRR3207728 file size 609185 SRR3207728 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207728 SRR3207728_1.fastq Input file: SRR3207728_1.fastq trimmed: SRR3207728-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 16:57:02 2025 >> started Mon Feb 10 16:57:03 2025 >> done (1.266s) 2904107 reads processed; of these: 5721 ( 0.20%) short reads filtered out after trimming by size control 9763 ( 0.34%) empty reads filtered out after trimming by size control 2888623 (99.47%) reads available; of these: 525185 (18.18%) trimmed reads available after processing 2363438 (81.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1147 0.04% 19 1913 0.07% 20 3696 0.13% 21 1180 0.04% 22 1771 0.06% 23 2888 0.10% 24 5181 0.18% 25 9167 0.32% 26 2033 0.07% 27 2693 0.09% 28 3848 0.13% 29 6086 0.21% 30 8885 0.31% 31 2406 0.08% 32 3590 0.12% 33 3670 0.13% 34 6010 0.21% 35 9848 0.34% 36 2859 0.10% 37 3533 0.12% 38 5652 0.20% 39 9288 0.32% 40 14883 0.52% 41 3573 0.12% 42 5050 0.17% 43 7299 0.25% 44 11369 0.39% 45 19146 0.66% 46 4652 0.16% 47 6218 0.22% 48 9458 0.33% 49 14623 0.51% 50 23608 0.82% 51 6210 0.21% 52 7559 0.26% 53 10857 0.38% 54 18148 0.63% 55 28753 1.00% 56 7259 0.25% 57 9339 0.32% 58 13981 0.48% 59 22855 0.79% 60 39609 1.37% 61 9068 0.31% 62 12152 0.42% 63 17292 0.60% 64 27138 0.94% 65 44261 1.53% 66 11000 0.38% 67 22481 0.78% 68 2363438 81.82% 2888623 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=14.52 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=1.9 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC Started job on | Feb 10 16:57:20 Started mapping on | Feb 10 16:57:20 Finished on | Feb 10 16:57:27 Mapping speed, Million of reads per hour | 1485.58 Number of input reads | 2888623 Average input read length | 64 UNIQUE READS: Uniquely mapped reads number | 1812833 Uniquely mapped reads % | 62.76% Average mapped length | 66.44 Number of splices: Total | 319097 Number of splices: Annotated (sjdb) | 313473 Number of splices: GT/AG | 314209 Number of splices: GC/AG | 3982 Number of splices: AT/AC | 381 Number of splices: Non-canonical | 525 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 82446 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 962787 % of reads mapped to too many loci | 33.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.04% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 993344 993344 993344 N_multimapping 82446 82446 82446 N_noFeature 140316 969228 970956 N_ambiguous 18978 2944 3099 UnstrandedReadsAssigned:1653539 PositiveStrandReadsAssigned:840661 NegativeStrandReadsAssigned:838778 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207728 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207728-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,888,623 reads, 2,492,047 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR3207728.ke.tsv 34699 SRR3207728.se.tsv 87100 total ==> SRR3207728.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 54 15.1608 Potri.005G024800.1.v4.1 1035 936 5.00789 2.88259 Potri.004G059700.1.v4.1 961 862 1 0.625024 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 33.5439 6.3546 Potri.016G087400.1.v4.1 270 171 62 195.344 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.965539 Potri.012G127500.1.v4.1 977 878 107 65.6589 ==> SRR3207728.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 194 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 32 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207728 completed mapping pipeline successfully