Starting /dee2/code/volunteer_pipeline.sh SRR3207729 current disk space = 3058202791936 free memory = 1289320292 SRR3207729 SRAfilesize 5d3f45c4b0d98a8841532ba8bc9e702f SRR3207729.sra SRR3207729.sra file validated SRR3207729 is single end SRR3207729 is conventional basespace SRR3207729 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207729_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.69275 39.0 38.0 40.0 33.0 40.0 2 37.3955 39.0 38.0 40.0 33.0 40.0 3 37.312 39.0 37.0 40.0 33.0 40.0 4 37.353 39.0 38.0 40.0 33.0 40.0 5 37.3985 39.0 38.0 40.0 33.0 40.0 6 37.35 39.0 37.0 40.0 33.0 40.0 7 37.32975 39.0 37.0 40.0 33.0 40.0 8 37.274 39.0 37.0 40.0 33.0 40.0 9 37.23825 39.0 36.0 40.0 33.0 40.0 10 37.26725 39.0 37.0 40.0 33.0 40.0 11 37.3225 39.0 37.0 40.0 33.0 40.0 12 37.1715 39.0 36.0 40.0 33.0 40.0 13 37.14125 39.0 36.0 40.0 33.0 40.0 14 37.24175 39.0 36.0 40.0 33.0 40.0 15 37.052 39.0 36.0 40.0 33.0 40.0 16 36.9375 39.0 36.0 40.0 32.0 40.0 17 36.925 39.0 36.0 40.0 31.0 40.0 18 36.97425 38.0 36.0 40.0 32.0 40.0 19 36.89425 38.0 36.0 40.0 31.0 40.0 20 36.698 38.0 36.0 40.0 31.0 40.0 21 36.676 38.0 36.0 40.0 31.0 40.0 22 36.622 38.0 36.0 40.0 31.0 40.0 23 36.47225 38.0 35.0 40.0 31.0 40.0 24 36.4205 38.0 35.0 40.0 31.0 40.0 25 36.24775 38.0 35.0 40.0 31.0 40.0 26 36.07925 38.0 35.0 39.0 30.0 40.0 27 36.03075 38.0 35.0 39.0 30.0 40.0 28 35.921 38.0 35.0 39.0 30.0 40.0 29 35.88675 38.0 35.0 39.0 30.0 40.0 30 35.7365 38.0 35.0 39.0 29.0 40.0 31 36.07625 38.0 35.0 39.0 30.0 40.0 32 35.8895 38.0 35.0 39.0 30.0 40.0 33 35.931 38.0 35.0 40.0 30.0 40.0 34 35.95525 38.0 35.0 40.0 30.0 40.0 35 35.85725 38.0 35.0 39.0 30.0 40.0 36 36.0405 38.0 35.0 40.0 30.0 40.0 37 35.8745 38.0 35.0 39.0 30.0 40.0 38 35.75725 38.0 35.0 39.0 29.0 40.0 39 35.63525 38.0 35.0 39.0 29.0 40.0 40 35.6475 38.0 35.0 39.0 29.0 40.0 41 35.53625 38.0 35.0 39.0 29.0 40.0 42 35.30075 38.0 35.0 39.0 29.0 40.0 43 35.33475 38.0 35.0 39.0 29.0 40.0 44 35.156 38.0 34.0 39.0 29.0 40.0 45 35.114 38.0 34.0 39.0 29.0 40.0 46 34.73775 38.0 34.0 39.0 28.0 40.0 47 34.5955 38.0 33.0 39.0 27.0 40.0 48 34.41925 37.0 33.0 39.0 27.0 40.0 49 34.05125 37.0 33.0 39.0 26.0 40.0 50 34.13225 37.0 33.0 39.0 26.0 40.0 51 34.1015 37.0 33.0 39.0 26.0 40.0 52 33.8255 37.0 33.0 39.0 25.0 40.0 53 33.66075 36.0 33.0 39.0 25.0 40.0 54 33.439 36.0 33.0 39.0 24.0 40.0 55 33.343 36.0 33.0 39.0 23.0 40.0 56 33.2735 36.0 33.0 39.0 24.0 40.0 57 32.8885 36.0 33.0 39.0 23.0 39.0 58 32.8595 36.0 33.0 39.0 23.0 39.0 59 32.501 36.0 32.0 39.0 22.0 39.0 60 32.41425 36.0 32.0 38.0 22.0 39.0 61 32.206 36.0 32.0 39.0 18.0 39.0 62 31.90625 36.0 31.0 38.0 17.0 39.0 63 31.61725 35.0 31.0 38.0 15.0 39.0 64 31.3595 35.0 31.0 38.0 8.0 39.0 65 30.969 35.0 30.0 38.0 2.0 39.0 66 30.5235 35.0 30.0 38.0 2.0 39.0 67 30.3985 35.0 30.0 38.0 2.0 39.0 68 29.41025 34.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 2.0 9 6.0 10 11.0 11 7.0 12 7.0 13 8.0 14 8.0 15 8.0 16 8.0 17 11.0 18 13.0 19 17.0 20 16.0 21 13.0 22 23.0 23 23.0 24 31.0 25 44.0 26 49.0 27 40.0 28 55.0 29 77.0 30 72.0 31 104.0 32 125.0 33 170.0 34 245.0 35 323.0 36 488.0 37 601.0 38 790.0 39 596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.648778029730412 14.73922902494331 16.52809271856891 43.08390022675737 2 19.375 25.825 36.575 18.224999999999998 3 22.225 31.125000000000004 24.2 22.45 4 25.025 33.925 19.425 21.625 5 23.825 36.1 22.475 17.599999999999998 6 18.575 37.35 23.974999999999998 20.1 7 16.575 15.65 45.225 22.55 8 18.65 23.025000000000002 29.025000000000002 29.299999999999997 9 20.75 22.7 31.075000000000003 25.474999999999998 10 20.575 39.6 22.425 17.4 11 24.825 27.800000000000004 22.125 25.25 12 20.1 23.7 30.0 26.200000000000003 13 18.825 27.450000000000003 32.2 21.525 14 20.9 26.3 30.3 22.5 15 20.925 27.525 28.4 23.150000000000002 16 21.675 27.150000000000002 29.15 22.025 17 21.875 29.5 27.450000000000003 21.175 18 22.3 28.1 27.85 21.75 19 20.974999999999998 28.849999999999998 28.000000000000004 22.175 20 23.125 27.55 27.474999999999998 21.85 21 21.3 28.475 27.400000000000002 22.825 22 22.6 28.15 26.325 22.925 23 22.925 28.7 27.35 21.025 24 20.525 28.499999999999996 29.099999999999998 21.875 25 22.325 27.700000000000003 28.075 21.9 26 21.0 28.525 28.925 21.55 27 20.775 28.499999999999996 27.750000000000004 22.975 28 21.349999999999998 28.599999999999998 27.400000000000002 22.650000000000002 29 21.575 28.875 28.325 21.224999999999998 30 22.25 28.475 27.075 22.2 31 21.675 28.549999999999997 28.000000000000004 21.775 32 21.3 28.575 27.650000000000002 22.475 33 20.875 28.299999999999997 28.025 22.8 34 21.325 27.625 28.449999999999996 22.6 35 21.099999999999998 29.599999999999998 27.6 21.7 36 21.2 28.299999999999997 29.4 21.099999999999998 37 22.025 28.499999999999996 27.500000000000004 21.975 38 22.55 28.299999999999997 26.575 22.575 39 21.375 28.075 28.9 21.65 40 21.775 28.975 27.250000000000004 22.0 41 22.275 28.175 29.175 20.375 42 21.8 27.900000000000002 28.675 21.625 43 21.3 28.599999999999998 27.625 22.475 44 22.0 28.4 28.9 20.7 45 22.0 27.400000000000002 28.625 21.975 46 22.85 26.674999999999997 28.449999999999996 22.025 47 21.775 28.875 27.200000000000003 22.15 48 20.849999999999998 28.499999999999996 28.449999999999996 22.2 49 21.725 28.849999999999998 27.700000000000003 21.725 50 22.325 28.249999999999996 28.299999999999997 21.125 51 22.525000000000002 28.1 27.925 21.45 52 22.5 29.125 26.575 21.8 53 21.025 29.425 27.825 21.725 54 20.525 29.45 28.375 21.65 55 21.875 28.199999999999996 28.175 21.75 56 21.625 28.499999999999996 28.225 21.65 57 21.325 28.599999999999998 27.975 22.1 58 23.549999999999997 26.825 27.450000000000003 22.175 59 21.95 27.025 28.425 22.6 60 20.1 28.050000000000004 29.15 22.7 61 22.625 27.650000000000002 27.775 21.95 62 21.6 29.2 27.875 21.325 63 22.650000000000002 28.050000000000004 28.125 21.175 64 22.15 27.700000000000003 28.199999999999996 21.95 65 21.625 29.225 27.35 21.8 66 22.375 28.075 28.275 21.275 67 21.975 27.425 27.750000000000004 22.85 68 21.425 29.349999999999998 28.075 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 2.0 19 2.0 20 1.5 21 4.0 22 7.0 23 8.0 24 9.5 25 10.0 26 15.0 27 20.5 28 21.0 29 31.0 30 46.5 31 52.0 32 57.0 33 83.0 34 104.0 35 118.0 36 159.0 37 186.0 38 200.0 39 244.0 40 291.0 41 308.0 42 357.5 43 395.0 44 383.0 45 357.5 46 335.0 47 338.0 48 297.5 49 251.0 50 245.0 51 207.0 52 147.5 53 126.0 54 119.5 55 83.5 56 54.0 57 48.0 58 39.0 59 36.0 60 28.0 61 14.5 62 9.0 63 6.5 64 4.5 65 4.0 66 3.0 67 2.5 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 1.0 74 1.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188879 spots for SRR3207729.sra Written 188879 spots for SRR3207729.sra Read 188892 spots for SRR3207729.sra Written 188892 spots for SRR3207729.sra SRR ids: ['SRR3207729.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2arbci5o SRR3207729.sra spots: 3777593 blocks: [[1, 188879], [188880, 377758], [377759, 566637], [566638, 755516], [755517, 944395], [944396, 1133274], [1133275, 1322153], [1322154, 1511032], [1511033, 1699911], [1699912, 1888790], [1888791, 2077669], [2077670, 2266548], [2266549, 2455427], [2455428, 2644306], [2644307, 2833185], [2833186, 3022064], [3022065, 3210943], [3210944, 3399822], [3399823, 3588701], [3588702, 3777593]] SRR3207729 file size 792732 SRR3207729 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207729 SRR3207729_1.fastq Input file: SRR3207729_1.fastq trimmed: SRR3207729-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:03:45 2025 >> started Mon Feb 10 17:03:47 2025 >> done (1.805s) 3777593 reads processed; of these: 5046 ( 0.13%) short reads filtered out after trimming by size control 10582 ( 0.28%) empty reads filtered out after trimming by size control 3761965 (99.59%) reads available; of these: 417107 (11.09%) trimmed reads available after processing 3344858 (88.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 812 0.02% 19 1358 0.04% 20 3313 0.09% 21 907 0.02% 22 1168 0.03% 23 1825 0.05% 24 3129 0.08% 25 5494 0.15% 26 1411 0.04% 27 1684 0.04% 28 2296 0.06% 29 3651 0.10% 30 5557 0.15% 31 1519 0.04% 32 2083 0.06% 33 2375 0.06% 34 3649 0.10% 35 5786 0.15% 36 1741 0.05% 37 2235 0.06% 38 3319 0.09% 39 5501 0.15% 40 9005 0.24% 41 2157 0.06% 42 2971 0.08% 43 4597 0.12% 44 7547 0.20% 45 12469 0.33% 46 3169 0.08% 47 4129 0.11% 48 6258 0.17% 49 10474 0.28% 50 17756 0.47% 51 4370 0.12% 52 5516 0.15% 53 8454 0.22% 54 14031 0.37% 55 23951 0.64% 56 5620 0.15% 57 7628 0.20% 58 11567 0.31% 59 19745 0.52% 60 34950 0.93% 61 7723 0.21% 62 10529 0.28% 63 15745 0.42% 64 26006 0.69% 65 44135 1.17% 66 10987 0.29% 67 24805 0.66% 68 3344858 88.91% 3761965 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=15.27 fanout-score-rank=12 prefix-density=0.09 prefix-fanout=6.6 sequence=CTGGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=185.91 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=21.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 17:04:00 Started mapping on | Feb 10 17:04:01 Finished on | Feb 10 17:04:05 Mapping speed, Million of reads per hour | 3385.77 Number of input reads | 3761965 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 3532802 Uniquely mapped reads % | 93.91% Average mapped length | 66.42 Number of splices: Total | 670008 Number of splices: Annotated (sjdb) | 659293 Number of splices: GT/AG | 660220 Number of splices: GC/AG | 8066 Number of splices: AT/AC | 746 Number of splices: Non-canonical | 976 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125187 % of reads mapped to multiple loci | 3.33% Number of reads mapped to too many loci | 59724 % of reads mapped to too many loci | 1.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 103976 103976 103976 N_multimapping 125187 125187 125187 N_noFeature 165676 1841174 1833317 N_ambiguous 34827 5365 5515 UnstrandedReadsAssigned:3332299 PositiveStrandReadsAssigned:1686263 NegativeStrandReadsAssigned:1693970 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207729 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207729-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,761,965 reads, 3,449,698 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR3207729.ke.tsv 34699 SRR3207729.se.tsv 87100 total ==> SRR3207729.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 86 19.4517 Potri.005G024800.1.v4.1 1035 936 16 7.41955 Potri.004G059700.1.v4.1 961 862 2 1.00706 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 67.395 10.2856 Potri.016G087400.1.v4.1 270 171 113 286.824 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11.4789 2.97631 Potri.012G127500.1.v4.1 977 878 288 142.374 ==> SRR3207729.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 339 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 63 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207729 completed mapping pipeline successfully