Starting /dee2/code/volunteer_pipeline.sh SRR3207730 current disk space = 3058074484736 free memory = 1298682136 SRR3207730 SRAfilesize c6f4e1c8bffbd247b7fe608639b365c2 SRR3207730.sra SRR3207730.sra file validated SRR3207730 is single end SRR3207730 is conventional basespace SRR3207730 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207730_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.264 39.0 38.0 40.0 33.0 40.0 2 37.1735 39.0 38.0 40.0 33.0 40.0 3 37.0835 39.0 38.0 40.0 33.0 40.0 4 37.1445 39.0 38.0 40.0 33.0 40.0 5 37.09075 39.0 38.0 40.0 33.0 40.0 6 37.161 39.0 37.0 40.0 33.0 40.0 7 37.1985 39.0 37.0 40.0 33.0 40.0 8 37.1115 39.0 37.0 40.0 33.0 40.0 9 37.01875 39.0 37.0 40.0 33.0 40.0 10 37.026 39.0 36.0 40.0 33.0 40.0 11 37.21325 39.0 37.0 40.0 33.0 40.0 12 37.062 39.0 36.0 40.0 32.0 40.0 13 37.0195 39.0 36.0 40.0 32.0 40.0 14 37.10775 39.0 36.0 40.0 33.0 40.0 15 37.09725 39.0 36.0 40.0 33.0 40.0 16 37.06375 39.0 36.0 40.0 33.0 40.0 17 36.8795 39.0 36.0 40.0 31.0 40.0 18 36.92875 39.0 36.0 40.0 31.0 40.0 19 36.831 38.0 36.0 40.0 31.0 40.0 20 36.85175 39.0 36.0 40.0 31.0 40.0 21 36.8695 38.0 36.0 40.0 31.0 40.0 22 36.56925 38.0 35.0 40.0 31.0 40.0 23 36.71575 38.0 36.0 40.0 31.0 40.0 24 36.604 38.0 35.0 40.0 31.0 40.0 25 36.533 38.0 35.0 40.0 31.0 40.0 26 36.19125 38.0 35.0 39.0 30.0 40.0 27 36.04775 38.0 35.0 39.0 30.0 40.0 28 35.92475 38.0 35.0 39.0 29.0 40.0 29 35.87525 38.0 35.0 39.0 30.0 40.0 30 35.71375 38.0 35.0 39.0 29.0 40.0 31 36.0465 38.0 35.0 39.0 30.0 40.0 32 35.8395 38.0 35.0 39.0 29.0 40.0 33 35.8575 38.0 35.0 39.0 30.0 40.0 34 35.8305 38.0 35.0 39.0 30.0 40.0 35 35.697 38.0 35.0 39.0 29.0 40.0 36 36.14225 38.0 35.0 40.0 31.0 40.0 37 35.99275 38.0 35.0 40.0 30.0 40.0 38 35.84725 38.0 35.0 39.0 30.0 40.0 39 35.80075 38.0 35.0 39.0 30.0 40.0 40 35.677 38.0 35.0 39.0 29.0 40.0 41 35.67175 38.0 35.0 39.0 30.0 40.0 42 35.5605 38.0 35.0 39.0 29.0 40.0 43 35.5455 38.0 35.0 39.0 29.0 40.0 44 35.357 38.0 34.0 39.0 29.0 40.0 45 35.1925 38.0 34.0 39.0 29.0 40.0 46 35.144 38.0 34.0 39.0 29.0 40.0 47 34.998 38.0 34.0 39.0 29.0 40.0 48 34.79725 38.0 33.0 39.0 28.0 40.0 49 34.6115 38.0 33.0 39.0 27.0 40.0 50 34.30725 37.0 33.0 39.0 27.0 40.0 51 34.29075 37.0 33.0 39.0 27.0 40.0 52 33.87675 37.0 33.0 39.0 25.0 40.0 53 33.68125 36.0 33.0 39.0 25.0 40.0 54 33.4785 36.0 33.0 39.0 24.0 40.0 55 33.55775 36.0 33.0 39.0 25.0 40.0 56 33.30275 36.0 33.0 39.0 23.0 40.0 57 32.8675 36.0 32.0 39.0 23.0 40.0 58 32.8205 36.0 32.0 39.0 23.0 40.0 59 32.79925 36.0 32.0 39.0 23.0 39.0 60 32.45625 36.0 31.0 39.0 23.0 39.0 61 31.63625 35.0 31.0 38.0 17.0 39.0 62 31.60475 35.0 31.0 38.0 17.0 39.0 63 31.1745 35.0 30.0 38.0 10.0 39.0 64 31.0325 35.0 30.0 38.0 2.0 39.0 65 30.70425 35.0 30.0 38.0 2.0 39.0 66 30.2 35.0 30.0 38.0 2.0 39.0 67 29.9915 35.0 29.0 38.0 2.0 39.0 68 29.21475 33.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 3.0 10 2.0 11 8.0 12 5.0 13 8.0 14 6.0 15 5.0 16 7.0 17 9.0 18 11.0 19 10.0 20 21.0 21 17.0 22 21.0 23 24.0 24 32.0 25 46.0 26 40.0 27 59.0 28 65.0 29 79.0 30 96.0 31 98.0 32 141.0 33 177.0 34 263.0 35 311.0 36 446.0 37 600.0 38 757.0 39 617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.725929699439632 14.849719816607236 17.26948548140601 42.15486500254712 2 18.15 25.674999999999997 37.1 19.075 3 22.25 28.825 26.575 22.35 4 23.575 33.975 20.225 22.225 5 24.2 37.2 21.9 16.7 6 17.349999999999998 37.625 24.575 20.45 7 16.0 18.325 43.575 22.1 8 19.275000000000002 22.375 30.925000000000004 27.425 9 19.25 22.875 32.5 25.374999999999996 10 20.125 38.175 23.95 17.75 11 25.1 27.250000000000004 21.224999999999998 26.424999999999997 12 20.9 23.849999999999998 29.625 25.624999999999996 13 18.175 27.750000000000004 32.875 21.2 14 20.200000000000003 28.625 29.25 21.925 15 21.025 27.200000000000003 28.199999999999996 23.575 16 21.4 28.475 27.1 23.025000000000002 17 21.175 28.849999999999998 27.3 22.675 18 21.375 27.925 29.25 21.45 19 21.3 28.349999999999998 28.875 21.475 20 21.675 28.375 27.825 22.125 21 21.775 28.749999999999996 28.050000000000004 21.425 22 21.75 29.799999999999997 25.6 22.85 23 20.45 29.525000000000002 28.4 21.625 24 21.15 29.025000000000002 28.15 21.675 25 20.75 30.099999999999998 27.3 21.85 26 22.35 28.449999999999996 27.950000000000003 21.25 27 21.8 28.7 26.875 22.625 28 21.875 28.825 27.500000000000004 21.8 29 22.0 29.475 26.125 22.400000000000002 30 21.025 28.175 28.175 22.625 31 21.55 29.099999999999998 27.200000000000003 22.15 32 22.0 30.0 27.175 20.825 33 21.955488872218055 29.382345586396596 28.032008002000502 20.630157539384847 34 21.55 28.15 27.650000000000002 22.650000000000002 35 20.775 28.375 27.400000000000002 23.45 36 21.925 28.849999999999998 26.825 22.400000000000002 37 22.0 28.849999999999998 26.825 22.325 38 20.974999999999998 30.099999999999998 27.950000000000003 20.974999999999998 39 21.65 28.749999999999996 27.950000000000003 21.65 40 22.775000000000002 27.775 26.875 22.575 41 23.35 27.900000000000002 27.474999999999998 21.275 42 22.5 28.349999999999998 27.775 21.375 43 21.175 28.549999999999997 28.1 22.175 44 20.925 27.425 30.025000000000002 21.625 45 20.325 27.700000000000003 29.049999999999997 22.925 46 21.175 28.675 28.125 22.025 47 21.3 29.175 27.35 22.175 48 21.4 29.2 27.275 22.125 49 22.375 27.500000000000004 27.325 22.8 50 21.45 28.9 27.525 22.125 51 22.425 27.950000000000003 27.700000000000003 21.925 52 21.475 27.775 28.749999999999996 22.0 53 22.85 28.050000000000004 26.25 22.85 54 20.599999999999998 29.099999999999998 28.075 22.225 55 20.525 29.375 27.474999999999998 22.625 56 22.400000000000002 29.45 26.724999999999998 21.425 57 21.425 28.15 27.85 22.575 58 20.724999999999998 29.349999999999998 26.825 23.1 59 21.4 27.675 27.925 23.0 60 21.099999999999998 28.075 28.275 22.55 61 21.525 27.450000000000003 28.749999999999996 22.275 62 22.575 27.55 27.650000000000002 22.225 63 22.0 27.075 27.950000000000003 22.975 64 21.224999999999998 29.125 28.249999999999996 21.4 65 21.625 27.900000000000002 28.025 22.45 66 21.4 28.1 27.35 23.150000000000002 67 20.424999999999997 29.75 27.400000000000002 22.425 68 21.65 29.425 27.150000000000002 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 2.5 19 2.0 20 2.0 21 5.0 22 8.0 23 8.5 24 6.5 25 4.0 26 11.0 27 23.0 28 28.0 29 36.5 30 51.0 31 57.0 32 73.0 33 91.5 34 94.0 35 115.0 36 147.5 37 159.0 38 201.0 39 283.0 40 323.0 41 323.0 42 336.0 43 374.5 44 400.0 45 364.0 46 320.0 47 312.0 48 286.0 49 231.0 50 202.0 51 190.0 52 142.5 53 107.0 54 100.5 55 80.5 56 67.0 57 58.5 58 39.0 59 28.0 60 26.5 61 22.5 62 20.0 63 14.0 64 8.0 65 8.0 66 8.0 67 6.0 68 2.5 69 1.0 70 0.5 71 2.0 72 4.0 73 2.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.025 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTGTT 15 0.0033454446 61.987503 14 >>END_MODULE Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249759 spots for SRR3207730.sra Written 249759 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra Read 249741 spots for SRR3207730.sra Written 249741 spots for SRR3207730.sra SRR ids: ['SRR3207730.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3kndi3fx SRR3207730.sra spots: 4994838 blocks: [[1, 249741], [249742, 499482], [499483, 749223], [749224, 998964], [998965, 1248705], [1248706, 1498446], [1498447, 1748187], [1748188, 1997928], [1997929, 2247669], [2247670, 2497410], [2497411, 2747151], [2747152, 2996892], [2996893, 3246633], [3246634, 3496374], [3496375, 3746115], [3746116, 3995856], [3995857, 4245597], [4245598, 4495338], [4495339, 4745079], [4745080, 4994838]] SRR3207730 file size 1048499 SRR3207730 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207730 SRR3207730_1.fastq Input file: SRR3207730_1.fastq trimmed: SRR3207730-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:36:49 2025 >> started Mon Feb 10 17:36:51 2025 >> done (2.416s) 4994838 reads processed; of these: 6182 ( 0.12%) short reads filtered out after trimming by size control 5035 ( 0.10%) empty reads filtered out after trimming by size control 4983621 (99.78%) reads available; of these: 519191 (10.42%) trimmed reads available after processing 4464430 (89.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 891 0.02% 19 1715 0.03% 20 2855 0.06% 21 988 0.02% 22 1362 0.03% 23 2147 0.04% 24 3675 0.07% 25 6758 0.14% 26 1556 0.03% 27 2125 0.04% 28 2801 0.06% 29 4264 0.09% 30 6649 0.13% 31 1910 0.04% 32 2607 0.05% 33 2861 0.06% 34 4418 0.09% 35 7241 0.15% 36 2101 0.04% 37 2739 0.05% 38 4092 0.08% 39 6758 0.14% 40 11112 0.22% 41 2820 0.06% 42 3820 0.08% 43 5472 0.11% 44 9359 0.19% 45 15214 0.31% 46 3840 0.08% 47 5272 0.11% 48 7632 0.15% 49 12665 0.25% 50 21862 0.44% 51 5276 0.11% 52 6817 0.14% 53 10122 0.20% 54 17525 0.35% 55 29042 0.58% 56 6868 0.14% 57 9440 0.19% 58 14184 0.28% 59 25040 0.50% 60 44935 0.90% 61 9672 0.19% 62 13021 0.26% 63 19922 0.40% 64 33552 0.67% 65 56100 1.13% 66 14128 0.28% 67 31966 0.64% 68 4464430 89.58% 4983621 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=14.89 fanout-score-rank=12 prefix-density=0.10 prefix-fanout=6.8 sequence=CTGGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=144.73 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=19.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 17:37:08 Started mapping on | Feb 10 17:37:08 Finished on | Feb 10 17:37:14 Mapping speed, Million of reads per hour | 2990.17 Number of input reads | 4983621 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4717231 Uniquely mapped reads % | 94.65% Average mapped length | 66.51 Number of splices: Total | 861910 Number of splices: Annotated (sjdb) | 847036 Number of splices: GT/AG | 848995 Number of splices: GC/AG | 10620 Number of splices: AT/AC | 918 Number of splices: Non-canonical | 1377 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164495 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 75348 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 101895 101895 101895 N_multimapping 164495 164495 164495 N_noFeature 237479 2463457 2456446 N_ambiguous 50505 7761 8018 UnstrandedReadsAssigned:4429247 PositiveStrandReadsAssigned:2246013 NegativeStrandReadsAssigned:2252767 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207730 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207730-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,983,621 reads, 4,584,109 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR3207730.ke.tsv 34699 SRR3207730.se.tsv 87100 total ==> SRR3207730.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 110 18.6505 Potri.005G024800.1.v4.1 1035 936 17 5.90944 Potri.004G059700.1.v4.1 961 862 1 0.377455 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 91.8512 10.5082 Potri.016G087400.1.v4.1 270 171 172 327.269 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 21.5931 4.19694 Potri.012G127500.1.v4.1 977 878 308 114.138 ==> SRR3207730.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 583 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 79 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207730 completed mapping pipeline successfully