Starting /dee2/code/volunteer_pipeline.sh SRR3207731 current disk space = 3058100060160 free memory = 1266112040 SRR3207731 SRAfilesize 36ee5f239f4b846cde8d87b202aac26e SRR3207731.sra SRR3207731.sra file validated SRR3207731 is single end SRR3207731 is conventional basespace SRR3207731 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207731_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.531 39.0 38.0 40.0 33.0 40.0 2 37.3295 39.0 38.0 40.0 33.0 40.0 3 37.22525 39.0 37.0 40.0 33.0 40.0 4 37.1585 39.0 38.0 40.0 33.0 40.0 5 37.18025 39.0 38.0 40.0 33.0 40.0 6 37.2365 39.0 37.0 40.0 33.0 40.0 7 37.3955 39.0 38.0 40.0 33.0 40.0 8 37.21275 39.0 37.0 40.0 33.0 40.0 9 37.11425 39.0 36.0 40.0 33.0 40.0 10 37.15525 39.0 37.0 40.0 33.0 40.0 11 37.33725 39.0 37.0 40.0 33.0 40.0 12 37.19175 39.0 36.0 40.0 33.0 40.0 13 37.16975 39.0 36.0 40.0 33.0 40.0 14 37.13875 39.0 36.0 40.0 33.0 40.0 15 37.05225 39.0 36.0 40.0 32.0 40.0 16 37.082 39.0 36.0 40.0 33.0 40.0 17 36.90525 39.0 36.0 40.0 31.0 40.0 18 36.89725 38.0 36.0 40.0 32.0 40.0 19 36.92975 38.0 36.0 40.0 32.0 40.0 20 36.8015 38.0 36.0 40.0 31.0 40.0 21 36.824 38.0 36.0 40.0 32.0 40.0 22 36.7315 38.0 36.0 40.0 31.0 40.0 23 36.69825 38.0 35.0 40.0 32.0 40.0 24 36.5415 38.0 35.0 40.0 31.0 40.0 25 36.4705 38.0 35.0 40.0 31.0 40.0 26 36.15275 38.0 35.0 39.0 30.0 40.0 27 36.03675 38.0 35.0 39.0 30.0 40.0 28 35.9185 38.0 35.0 39.0 29.0 40.0 29 35.73225 38.0 35.0 39.0 29.0 40.0 30 35.6415 38.0 35.0 39.0 29.0 40.0 31 35.848 38.0 35.0 39.0 29.0 40.0 32 35.84775 38.0 35.0 39.0 30.0 40.0 33 35.764 38.0 35.0 39.0 30.0 40.0 34 35.7035 38.0 35.0 39.0 29.0 40.0 35 35.64975 38.0 35.0 39.0 29.0 40.0 36 36.0435 38.0 35.0 39.0 30.0 40.0 37 35.88625 38.0 35.0 39.0 30.0 40.0 38 35.80475 38.0 35.0 39.0 29.0 40.0 39 35.70425 38.0 35.0 39.0 29.0 40.0 40 35.63125 38.0 35.0 39.0 29.0 40.0 41 35.5155 38.0 35.0 39.0 29.0 40.0 42 35.414 38.0 35.0 39.0 29.0 40.0 43 35.3545 38.0 35.0 39.0 29.0 40.0 44 35.08525 38.0 34.0 39.0 28.0 40.0 45 34.91975 38.0 34.0 39.0 27.0 40.0 46 34.886 38.0 34.0 39.0 28.0 40.0 47 34.77 38.0 34.0 39.0 27.0 40.0 48 34.49725 38.0 33.0 39.0 27.0 40.0 49 34.33925 38.0 33.0 39.0 26.0 40.0 50 34.12125 37.0 33.0 39.0 26.0 40.0 51 34.1425 37.0 33.0 39.0 27.0 40.0 52 33.8545 37.0 33.0 39.0 25.0 40.0 53 33.4265 36.0 33.0 39.0 24.0 40.0 54 33.59525 36.0 33.0 39.0 25.0 40.0 55 33.4905 36.0 33.0 39.0 25.0 40.0 56 32.976 36.0 33.0 39.0 23.0 40.0 57 32.66175 36.0 32.0 39.0 22.0 39.0 58 32.723 36.0 32.0 39.0 23.0 40.0 59 32.41425 36.0 32.0 39.0 22.0 39.0 60 32.14125 36.0 31.0 39.0 18.0 39.0 61 31.572 35.0 31.0 38.0 14.0 39.0 62 31.512 35.0 31.0 38.0 13.0 39.0 63 31.39 35.0 31.0 38.0 11.0 39.0 64 31.079 35.0 31.0 38.0 2.0 39.0 65 30.73575 35.0 30.0 38.0 2.0 39.0 66 30.28275 35.0 30.0 38.0 2.0 39.0 67 30.15175 35.0 29.0 38.0 2.0 39.0 68 29.202 33.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 0.0 5 3.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 5.0 12 6.0 13 6.0 14 6.0 15 7.0 16 10.0 17 17.0 18 21.0 19 19.0 20 25.0 21 18.0 22 24.0 23 22.0 24 26.0 25 38.0 26 30.0 27 48.0 28 71.0 29 76.0 30 88.0 31 114.0 32 126.0 33 179.0 34 244.0 35 308.0 36 459.0 37 632.0 38 736.0 39 619.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.03789792824659 13.56745831227893 19.580596260737746 41.814047498736734 2 20.0 24.6 36.275 19.125 3 21.575 28.749999999999996 27.125 22.55 4 23.325000000000003 34.025 20.8 21.85 5 24.0 35.075 21.925 19.0 6 17.45 38.0 23.9 20.65 7 17.575 15.35 45.0 22.075 8 19.7 22.375 27.975 29.95 9 19.975 23.5 30.85 25.674999999999997 10 20.7 39.2 21.975 18.125 11 24.975 28.375 20.925 25.724999999999998 12 21.3 24.825 28.325 25.55 13 19.025 28.999999999999996 31.424999999999997 20.549999999999997 14 20.45 26.200000000000003 30.55 22.8 15 20.974999999999998 27.725 28.025 23.275000000000002 16 22.15 28.299999999999997 27.675 21.875 17 22.875 28.125 26.6 22.400000000000002 18 21.375 28.000000000000004 27.325 23.3 19 21.475 27.800000000000004 27.875 22.85 20 21.975 28.65 27.1 22.275 21 20.8 28.625 28.025 22.55 22 22.025 28.499999999999996 26.55 22.925 23 20.424999999999997 28.000000000000004 28.15 23.425 24 20.95 28.975 27.375 22.7 25 22.225 28.925 26.950000000000003 21.9 26 21.7 29.049999999999997 27.525 21.725 27 20.7 28.4 29.15 21.75 28 22.7 26.950000000000003 28.999999999999996 21.349999999999998 29 22.425 28.025 27.700000000000003 21.85 30 20.549999999999997 29.175 28.325 21.95 31 20.95 28.249999999999996 27.525 23.275000000000002 32 23.0 27.375 27.875 21.75 33 22.55 27.750000000000004 27.825 21.875 34 21.075 28.050000000000004 27.85 23.025000000000002 35 20.674999999999997 29.225 28.275 21.825 36 21.55 26.875 29.375 22.2 37 21.575 28.025 27.875 22.525000000000002 38 22.025 27.525 28.7 21.75 39 20.549999999999997 28.875 28.299999999999997 22.275 40 22.2 26.775 27.825 23.200000000000003 41 22.53063265816454 28.40710177544386 28.032008002000502 21.030257564391096 42 22.650000000000002 28.375 27.6 21.375 43 21.9 28.1 27.85 22.15 44 21.175 29.15 27.525 22.15 45 21.325 28.475 28.199999999999996 22.0 46 21.975 27.700000000000003 27.375 22.95 47 21.725 28.075 28.299999999999997 21.9 48 21.8 29.625 27.150000000000002 21.425 49 21.725 29.225 26.700000000000003 22.35 50 21.85 29.275000000000002 27.05 21.825 51 21.625 27.650000000000002 28.499999999999996 22.225 52 22.15 26.875 28.1 22.875 53 21.349999999999998 28.549999999999997 27.950000000000003 22.15 54 22.7 28.225 27.125 21.95 55 23.0 26.575 27.85 22.575 56 22.2 28.525 27.3 21.975 57 21.65 29.099999999999998 27.575 21.675 58 22.875 26.900000000000002 27.875 22.35 59 22.025 28.075 28.525 21.375 60 21.125 28.349999999999998 27.925 22.6 61 21.9 27.625 27.85 22.625 62 20.8 28.749999999999996 28.275 22.175 63 22.725 27.775 28.249999999999996 21.25 64 22.225 27.950000000000003 27.875 21.95 65 21.4 28.95 27.275 22.375 66 22.675 27.425 28.625 21.275 67 22.375 28.075 26.825 22.725 68 21.975 28.975 26.825 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 3.0 17 2.0 18 1.5 19 2.0 20 2.5 21 2.5 22 2.0 23 3.5 24 9.0 25 13.0 26 12.5 27 15.0 28 18.0 29 31.0 30 48.0 31 52.0 32 58.0 33 80.0 34 96.0 35 119.5 36 163.5 37 184.0 38 205.0 39 253.0 40 300.0 41 320.0 42 342.5 43 369.0 44 373.0 45 364.5 46 336.0 47 316.0 48 291.5 49 237.5 50 208.0 51 182.5 52 148.5 53 140.0 54 114.0 55 79.0 56 70.0 57 60.5 58 49.5 59 48.0 60 39.0 61 23.5 62 17.0 63 14.5 64 9.5 65 6.5 66 6.0 67 5.5 68 3.5 69 2.0 70 4.0 71 5.0 72 4.0 73 2.0 74 1.0 75 2.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265463 spots for SRR3207731.sra Written 265463 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra Read 265460 spots for SRR3207731.sra Written 265460 spots for SRR3207731.sra SRR ids: ['SRR3207731.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pvicmwhm SRR3207731.sra spots: 5309203 blocks: [[1, 265460], [265461, 530920], [530921, 796380], [796381, 1061840], [1061841, 1327300], [1327301, 1592760], [1592761, 1858220], [1858221, 2123680], [2123681, 2389140], [2389141, 2654600], [2654601, 2920060], [2920061, 3185520], [3185521, 3450980], [3450981, 3716440], [3716441, 3981900], [3981901, 4247360], [4247361, 4512820], [4512821, 4778280], [4778281, 5043740], [5043741, 5309203]] SRR3207731 file size 1114557 SRR3207731 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207731 SRR3207731_1.fastq Input file: SRR3207731_1.fastq trimmed: SRR3207731-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:20:45 2025 >> started Mon Feb 10 17:20:48 2025 >> done (2.502s) 5309203 reads processed; of these: 6530 ( 0.12%) short reads filtered out after trimming by size control 6829 ( 0.13%) empty reads filtered out after trimming by size control 5295844 (99.75%) reads available; of these: 552379 (10.43%) trimmed reads available after processing 4743465 (89.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 929 0.02% 19 1701 0.03% 20 3030 0.06% 21 979 0.02% 22 1422 0.03% 23 2223 0.04% 24 3817 0.07% 25 7005 0.13% 26 1673 0.03% 27 2290 0.04% 28 3002 0.06% 29 4636 0.09% 30 7186 0.14% 31 1938 0.04% 32 2593 0.05% 33 3113 0.06% 34 4836 0.09% 35 7634 0.14% 36 2178 0.04% 37 2955 0.06% 38 4329 0.08% 39 7160 0.14% 40 11935 0.23% 41 2864 0.05% 42 3966 0.07% 43 5875 0.11% 44 9829 0.19% 45 16408 0.31% 46 4119 0.08% 47 5533 0.10% 48 8301 0.16% 49 13628 0.26% 50 23406 0.44% 51 5599 0.11% 52 7111 0.13% 53 10903 0.21% 54 18581 0.35% 55 31180 0.59% 56 7301 0.14% 57 10008 0.19% 58 15365 0.29% 59 26283 0.50% 60 48086 0.91% 61 10284 0.19% 62 13638 0.26% 63 21150 0.40% 64 35729 0.67% 65 59843 1.13% 66 14905 0.28% 67 33920 0.64% 68 4743465 89.57% 5295844 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=6.55 fanout-score-rank=18 prefix-density=0.08 prefix-fanout=3.4 sequence=GCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=180.74 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.4 sequence=TTCTTCTTCTTC Started job on | Feb 10 17:21:11 Started mapping on | Feb 10 17:21:11 Finished on | Feb 10 17:21:19 Mapping speed, Million of reads per hour | 2383.13 Number of input reads | 5295844 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5019701 Uniquely mapped reads % | 94.79% Average mapped length | 66.50 Number of splices: Total | 950660 Number of splices: Annotated (sjdb) | 935703 Number of splices: GT/AG | 936474 Number of splices: GC/AG | 11737 Number of splices: AT/AC | 1047 Number of splices: Non-canonical | 1402 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 175564 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 73845 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 100579 100579 100579 N_multimapping 175564 175564 175564 N_noFeature 229152 2611079 2606248 N_ambiguous 47290 7624 8207 UnstrandedReadsAssigned:4743259 PositiveStrandReadsAssigned:2400998 NegativeStrandReadsAssigned:2405246 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207731 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207731-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,295,844 reads, 4,899,394 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR3207731.ke.tsv 34699 SRR3207731.se.tsv 87100 total ==> SRR3207731.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 124 19.6213 Potri.005G024800.1.v4.1 1035 936 17 5.5151 Potri.004G059700.1.v4.1 961 862 1 0.352268 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 90.9011 9.70554 Potri.016G087400.1.v4.1 270 171 194 344.497 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.049 2.72982 Potri.012G127500.1.v4.1 977 878 452 156.324 ==> SRR3207731.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 507 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 88 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207731 completed mapping pipeline successfully