Starting /dee2/code/volunteer_pipeline.sh SRR3207732 current disk space = 3058012852224 free memory = 1130613316 SRR3207732 SRAfilesize b70f7b075115296d1a653e1bffd5baf9 SRR3207732.sra SRR3207732.sra file validated SRR3207732 is single end SRR3207732 is conventional basespace SRR3207732 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207732_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.21275 39.0 38.0 40.0 33.0 40.0 2 37.08775 39.0 38.0 40.0 33.0 40.0 3 37.0055 39.0 37.0 40.0 33.0 40.0 4 36.9955 39.0 38.0 40.0 33.0 40.0 5 37.0695 39.0 38.0 40.0 33.0 40.0 6 37.05275 39.0 37.0 40.0 33.0 40.0 7 37.12375 39.0 38.0 40.0 33.0 40.0 8 37.0465 39.0 37.0 40.0 33.0 40.0 9 36.854 39.0 36.0 40.0 32.0 40.0 10 37.0095 39.0 37.0 40.0 32.0 40.0 11 37.33175 39.0 37.0 40.0 33.0 40.0 12 37.174 39.0 37.0 40.0 33.0 40.0 13 37.01925 39.0 36.0 40.0 31.0 40.0 14 37.0965 39.0 36.0 40.0 32.0 40.0 15 37.12025 39.0 36.0 40.0 32.0 40.0 16 37.15675 39.0 36.0 40.0 32.0 40.0 17 36.96025 39.0 36.0 40.0 31.0 40.0 18 36.89475 39.0 36.0 40.0 31.0 40.0 19 36.90575 38.0 36.0 40.0 31.0 40.0 20 36.7045 38.0 36.0 40.0 31.0 40.0 21 36.751 38.0 36.0 40.0 31.0 40.0 22 36.64275 38.0 35.0 40.0 31.0 40.0 23 36.61625 38.0 35.0 40.0 31.0 40.0 24 36.44225 38.0 35.0 40.0 31.0 40.0 25 36.37175 38.0 35.0 40.0 31.0 40.0 26 36.072 38.0 35.0 39.0 30.0 40.0 27 36.06125 38.0 35.0 39.0 30.0 40.0 28 35.77775 38.0 35.0 39.0 29.0 40.0 29 35.69425 38.0 35.0 39.0 29.0 40.0 30 35.64125 38.0 35.0 39.0 29.0 40.0 31 35.8575 38.0 35.0 39.0 30.0 40.0 32 35.8125 38.0 35.0 39.0 29.0 40.0 33 35.716 38.0 35.0 40.0 29.0 40.0 34 35.6145 38.0 35.0 39.0 29.0 40.0 35 35.565 38.0 35.0 39.0 29.0 40.0 36 35.92025 38.0 35.0 40.0 30.0 40.0 37 35.71275 38.0 35.0 39.0 29.0 40.0 38 35.62625 38.0 35.0 39.0 29.0 40.0 39 35.67 38.0 35.0 39.0 29.0 40.0 40 35.4585 38.0 35.0 39.0 29.0 40.0 41 35.3875 38.0 35.0 39.0 29.0 40.0 42 35.291 38.0 35.0 39.0 29.0 40.0 43 35.2295 38.0 35.0 39.0 29.0 40.0 44 35.036 38.0 34.0 39.0 28.0 40.0 45 34.866 38.0 34.0 39.0 27.0 40.0 46 34.681 38.0 34.0 39.0 27.0 40.0 47 34.64075 38.0 34.0 39.0 27.0 40.0 48 34.46475 38.0 33.0 39.0 27.0 40.0 49 34.33 38.0 33.0 39.0 27.0 40.0 50 33.91525 37.0 33.0 39.0 25.0 40.0 51 34.0145 37.0 33.0 39.0 25.0 40.0 52 33.6775 37.0 33.0 39.0 25.0 40.0 53 33.4885 36.0 33.0 39.0 24.0 40.0 54 33.26725 36.0 33.0 39.0 23.0 40.0 55 33.33275 36.0 33.0 39.0 23.0 40.0 56 33.0165 36.0 33.0 39.0 23.0 40.0 57 32.62075 36.0 32.0 39.0 22.0 39.0 58 32.5345 36.0 32.0 39.0 22.0 39.0 59 32.4595 36.0 32.0 39.0 22.0 39.0 60 32.0895 36.0 31.0 38.0 17.0 39.0 61 31.37225 35.0 31.0 38.0 11.0 39.0 62 31.2525 35.0 31.0 38.0 2.0 39.0 63 30.87475 35.0 30.0 38.0 2.0 39.0 64 30.78225 35.0 30.0 38.0 2.0 39.0 65 30.417 35.0 30.0 38.0 2.0 39.0 66 29.846 35.0 29.0 38.0 2.0 39.0 67 29.7 34.0 29.0 38.0 2.0 39.0 68 28.85975 33.0 27.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 1.0 5 2.0 6 0.0 7 2.0 8 4.0 9 5.0 10 4.0 11 6.0 12 9.0 13 8.0 14 9.0 15 8.0 16 9.0 17 15.0 18 21.0 19 23.0 20 14.0 21 17.0 22 29.0 23 30.0 24 31.0 25 42.0 26 59.0 27 57.0 28 62.0 29 72.0 30 67.0 31 119.0 32 125.0 33 153.0 34 201.0 35 347.0 36 444.0 37 616.0 38 757.0 39 623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.93103448275862 14.533844189016603 23.60153256704981 43.93358876117497 2 19.7 25.924999999999997 35.099999999999994 19.275000000000002 3 22.55 29.175 26.474999999999998 21.8 4 24.45 32.550000000000004 20.849999999999998 22.15 5 23.974999999999998 35.175 23.25 17.599999999999998 6 18.425 39.15 22.900000000000002 19.525000000000002 7 16.1 15.75 46.525 21.625 8 20.325 22.75 28.549999999999997 28.375 9 19.650000000000002 22.225 31.900000000000002 26.224999999999998 10 19.45 39.85 23.025000000000002 17.675 11 26.474999999999998 27.950000000000003 20.175 25.4 12 20.625 25.05 29.349999999999998 24.975 13 19.725 26.875 31.85 21.55 14 21.45 28.925 29.15 20.474999999999998 15 20.7 26.900000000000002 28.825 23.575 16 21.825 27.275 29.349999999999998 21.55 17 22.2 28.025 28.15 21.625 18 22.025 27.525 27.825 22.625 19 20.575 27.975 28.075 23.375 20 21.6 28.325 28.575 21.5 21 21.45 29.075 27.650000000000002 21.825 22 20.875 27.775 27.875 23.474999999999998 23 20.95 29.599999999999998 27.35 22.1 24 20.5 27.975 28.799999999999997 22.725 25 20.25 29.599999999999998 27.725 22.425 26 21.25 28.549999999999997 27.925 22.275 27 21.625 28.249999999999996 26.35 23.775 28 20.125 28.825 28.525 22.525000000000002 29 22.400000000000002 28.549999999999997 27.425 21.625 30 21.45 27.575 28.599999999999998 22.375 31 20.125 29.175 28.4 22.3 32 21.525 28.65 28.4 21.425 33 22.2 28.125 27.800000000000004 21.875 34 21.025 29.049999999999997 27.425 22.5 35 20.549999999999997 29.225 28.4 21.825 36 21.15 28.15 28.1 22.6 37 21.475 29.299999999999997 27.925 21.3 38 21.725 27.725 28.475 22.075 39 21.85 27.700000000000003 27.450000000000003 23.0 40 21.975 28.675 27.150000000000002 22.2 41 21.605401350337583 29.307326831707925 28.28207051762941 20.80520130032508 42 22.825 28.825 26.325 22.025 43 21.725 28.9 27.55 21.825 44 21.375 29.375 28.125 21.125 45 21.5 27.700000000000003 28.875 21.925 46 21.775 28.725 27.250000000000004 22.25 47 22.2 28.849999999999998 26.85 22.1 48 21.15 28.749999999999996 28.075 22.025 49 22.900000000000002 27.675 27.675 21.75 50 21.925 28.725 27.35 22.0 51 21.0 29.225 28.1 21.675 52 22.275 27.975 29.2 20.549999999999997 53 22.825 29.075 27.450000000000003 20.65 54 22.2 26.650000000000002 28.599999999999998 22.55 55 20.525 29.425 28.000000000000004 22.05 56 22.025 28.349999999999998 27.975 21.65 57 21.85 27.425 28.475 22.25 58 21.825 28.249999999999996 27.800000000000004 22.125 59 22.325 27.800000000000004 28.775000000000002 21.099999999999998 60 22.575 28.025 28.125 21.275 61 21.7 27.900000000000002 28.575 21.825 62 21.975 28.525 28.349999999999998 21.15 63 21.85 29.575000000000003 26.85 21.725 64 22.575 28.275 27.85 21.3 65 22.3 28.475 27.925 21.3 66 22.0 26.55 29.95 21.5 67 21.0 28.849999999999998 28.549999999999997 21.6 68 22.7 26.974999999999998 27.800000000000004 22.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 2.0 23 4.5 24 11.5 25 16.0 26 16.5 27 29.5 28 42.0 29 41.5 30 50.5 31 60.0 32 84.5 33 103.0 34 97.0 35 111.5 36 183.0 37 240.0 38 237.0 39 248.5 40 289.0 41 315.0 42 337.5 43 343.5 44 327.0 45 329.0 46 318.0 47 305.0 48 298.5 49 248.5 50 205.0 51 180.5 52 135.5 53 115.0 54 103.5 55 82.0 56 72.0 57 62.0 58 43.0 59 34.0 60 28.5 61 21.0 62 19.0 63 16.0 64 8.5 65 4.5 66 5.0 67 4.0 68 2.0 69 1.0 70 4.5 71 4.5 72 1.0 73 1.0 74 0.5 75 0.0 76 1.5 77 2.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.15 0.0 0.0 0.0 0.0 34 0.15 0.0 0.0 0.0 0.0 35 0.15 0.0 0.0 0.0 0.0 36 0.15 0.0 0.0 0.0 0.0 37 0.15 0.0 0.0 0.0 0.0 38 0.15 0.0 0.0 0.0 0.0 39 0.15 0.0 0.0 0.0 0.0 40 0.175 0.0 0.0 0.0 0.0 41 0.175 0.0 0.0 0.0 0.0 42 0.175 0.0 0.0 0.0 0.0 43 0.175 0.0 0.0 0.0 0.0 44 0.175 0.0 0.0 0.0 0.0 45 0.175 0.0 0.0 0.0 0.0 46 0.175 0.0 0.0 0.0 0.0 47 0.175 0.0 0.0 0.0 0.0 48 0.175 0.0 0.0 0.0 0.0 49 0.175 0.0 0.0 0.0 0.0 50 0.175 0.0 0.0 0.0 0.0 51 0.175 0.0 0.0 0.0 0.0 52 0.175 0.0 0.0 0.0 0.0 53 0.175 0.0 0.0 0.0 0.0 54 0.175 0.0 0.0 0.0 0.0 55 0.175 0.0 0.0 0.0 0.0 56 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345922 spots for SRR3207732.sra Written 345922 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra Read 345921 spots for SRR3207732.sra Written 345921 spots for SRR3207732.sra SRR ids: ['SRR3207732.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n9_44cko SRR3207732.sra spots: 6918421 blocks: [[1, 345921], [345922, 691842], [691843, 1037763], [1037764, 1383684], [1383685, 1729605], [1729606, 2075526], [2075527, 2421447], [2421448, 2767368], [2767369, 3113289], [3113290, 3459210], [3459211, 3805131], [3805132, 4151052], [4151053, 4496973], [4496974, 4842894], [4842895, 5188815], [5188816, 5534736], [5534737, 5880657], [5880658, 6226578], [6226579, 6572499], [6572500, 6918421]] SRR3207732 file size 1452714 SRR3207732 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207732 SRR3207732_1.fastq Input file: SRR3207732_1.fastq trimmed: SRR3207732-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:28:24 2025 >> started Mon Feb 10 17:28:28 2025 >> done (4.015s) 6918421 reads processed; of these: 8666 ( 0.13%) short reads filtered out after trimming by size control 16422 ( 0.24%) empty reads filtered out after trimming by size control 6893333 (99.64%) reads available; of these: 699239 (10.14%) trimmed reads available after processing 6194094 (89.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1258 0.02% 19 2261 0.03% 20 4073 0.06% 21 1323 0.02% 22 1882 0.03% 23 2996 0.04% 24 5132 0.07% 25 9226 0.13% 26 2119 0.03% 27 2867 0.04% 28 3862 0.06% 29 6073 0.09% 30 9202 0.13% 31 2571 0.04% 32 3373 0.05% 33 3854 0.06% 34 6092 0.09% 35 10009 0.15% 36 2965 0.04% 37 3768 0.05% 38 5591 0.08% 39 9099 0.13% 40 14897 0.22% 41 3772 0.05% 42 5133 0.07% 43 7526 0.11% 44 12571 0.18% 45 20758 0.30% 46 5060 0.07% 47 6845 0.10% 48 10339 0.15% 49 16822 0.24% 50 29271 0.42% 51 7106 0.10% 52 8941 0.13% 53 13615 0.20% 54 23392 0.34% 55 39220 0.57% 56 9172 0.13% 57 12450 0.18% 58 19148 0.28% 59 33147 0.48% 60 60835 0.88% 61 12804 0.19% 62 17688 0.26% 63 26614 0.39% 64 45031 0.65% 65 75672 1.10% 66 18590 0.27% 67 43224 0.63% 68 6194094 89.86% 6893333 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=34 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=150.90 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=19.1 sequence=TTCTTCTTCTTT Started job on | Feb 10 17:28:44 Started mapping on | Feb 10 17:28:44 Finished on | Feb 10 17:28:58 Mapping speed, Million of reads per hour | 1772.57 Number of input reads | 6893333 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6523269 Uniquely mapped reads % | 94.63% Average mapped length | 66.52 Number of splices: Total | 1192228 Number of splices: Annotated (sjdb) | 1172474 Number of splices: GT/AG | 1174736 Number of splices: GC/AG | 14439 Number of splices: AT/AC | 1248 Number of splices: Non-canonical | 1805 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223610 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 109837 % of reads mapped to too many loci | 1.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 146454 146454 146454 N_multimapping 223610 223610 223610 N_noFeature 320602 3400504 3396456 N_ambiguous 67166 9901 10429 UnstrandedReadsAssigned:6135501 PositiveStrandReadsAssigned:3112864 NegativeStrandReadsAssigned:3116384 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207732 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207732-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,893,333 reads, 6,346,227 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52401 SRR3207732.ke.tsv 34699 SRR3207732.se.tsv 87100 total ==> SRR3207732.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 186 22.5882 Potri.005G024800.1.v4.1 1035 936 28 6.97149 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 106.16 8.69915 Potri.016G087400.1.v4.1 270 171 246 335.261 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27.6921 3.85517 Potri.012G127500.1.v4.1 977 878 573 152.091 ==> SRR3207732.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 691 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 105 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207732 completed mapping pipeline successfully