Starting /dee2/code/volunteer_pipeline.sh SRR3207733 current disk space = 3058080702464 free memory = 1255171468 SRR3207733 SRAfilesize c6f0b7686c968fdd51a613f043d14c26 SRR3207733.sra SRR3207733.sra file validated SRR3207733 is single end SRR3207733 is conventional basespace SRR3207733 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207733_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.334 39.0 38.0 40.0 33.0 40.0 2 37.14075 39.0 37.0 40.0 33.0 40.0 3 37.07375 39.0 37.0 40.0 33.0 40.0 4 37.13325 39.0 37.0 40.0 33.0 40.0 5 37.0725 39.0 37.0 40.0 33.0 40.0 6 37.0575 39.0 37.0 40.0 33.0 40.0 7 37.16275 39.0 37.0 40.0 33.0 40.0 8 37.013 39.0 37.0 40.0 32.0 40.0 9 36.9335 39.0 36.0 40.0 32.0 40.0 10 37.0305 39.0 37.0 40.0 33.0 40.0 11 37.14275 39.0 36.0 40.0 33.0 40.0 12 36.93075 39.0 36.0 40.0 31.0 40.0 13 37.05275 39.0 36.0 40.0 32.0 40.0 14 37.1055 39.0 36.0 40.0 33.0 40.0 15 36.89425 39.0 36.0 40.0 31.0 40.0 16 36.78725 38.0 36.0 40.0 31.0 40.0 17 36.718 38.0 36.0 40.0 31.0 40.0 18 36.637 38.0 35.0 40.0 31.0 40.0 19 36.598 38.0 36.0 40.0 31.0 40.0 20 36.4845 38.0 35.0 40.0 31.0 40.0 21 36.47675 38.0 35.0 40.0 31.0 40.0 22 36.493 38.0 35.0 40.0 31.0 40.0 23 36.26375 38.0 35.0 40.0 31.0 40.0 24 36.12325 38.0 35.0 40.0 30.0 40.0 25 36.05225 38.0 35.0 39.0 30.0 40.0 26 35.801 38.0 35.0 39.0 29.0 40.0 27 35.7505 38.0 35.0 39.0 29.0 40.0 28 35.496 38.0 35.0 39.0 29.0 40.0 29 35.4345 38.0 35.0 39.0 29.0 40.0 30 35.2815 38.0 34.0 39.0 29.0 40.0 31 35.5425 38.0 35.0 39.0 29.0 40.0 32 35.576 38.0 35.0 39.0 29.0 40.0 33 35.46125 38.0 35.0 39.0 29.0 40.0 34 35.471 38.0 35.0 39.0 29.0 40.0 35 35.36 38.0 35.0 39.0 29.0 40.0 36 35.2575 38.0 35.0 39.0 29.0 40.0 37 35.28225 38.0 35.0 39.0 29.0 40.0 38 35.11525 38.0 35.0 39.0 28.0 40.0 39 34.889 38.0 34.0 39.0 28.0 40.0 40 34.89775 38.0 34.0 39.0 27.0 40.0 41 34.72975 38.0 34.0 39.0 28.0 40.0 42 34.5925 38.0 33.0 39.0 27.0 40.0 43 34.594 38.0 33.0 39.0 27.0 40.0 44 34.46275 37.0 33.0 39.0 27.0 40.0 45 34.26425 37.0 33.0 39.0 27.0 40.0 46 33.94775 37.0 33.0 39.0 25.0 40.0 47 33.86025 37.0 33.0 39.0 25.0 40.0 48 33.71375 36.0 33.0 39.0 25.0 40.0 49 33.223 36.0 32.0 39.0 23.0 40.0 50 33.33725 36.0 33.0 39.0 24.0 40.0 51 33.246 36.0 33.0 39.0 23.0 40.0 52 32.89725 36.0 32.0 39.0 23.0 40.0 53 32.664 36.0 32.0 39.0 22.0 40.0 54 32.473 36.0 32.0 39.0 22.0 39.0 55 32.277 36.0 31.0 38.0 21.0 39.0 56 32.188 36.0 32.0 38.0 18.0 39.0 57 31.83525 35.0 31.0 38.0 18.0 39.0 58 31.63925 35.0 31.0 38.0 17.0 39.0 59 31.398 35.0 31.0 38.0 17.0 39.0 60 31.08075 35.0 31.0 38.0 9.0 39.0 61 30.8965 35.0 31.0 38.0 2.0 39.0 62 30.626 35.0 31.0 38.0 2.0 39.0 63 30.26925 34.0 30.0 38.0 2.0 39.0 64 29.88575 34.0 29.0 37.0 2.0 39.0 65 29.45625 33.0 29.0 37.0 2.0 39.0 66 29.014 33.0 28.0 36.0 2.0 39.0 67 28.873 33.0 28.0 36.0 2.0 39.0 68 28.105 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 3.0 6 1.0 7 4.0 8 3.0 9 3.0 10 8.0 11 13.0 12 14.0 13 7.0 14 13.0 15 12.0 16 16.0 17 22.0 18 18.0 19 17.0 20 18.0 21 22.0 22 19.0 23 30.0 24 35.0 25 40.0 26 39.0 27 60.0 28 74.0 29 87.0 30 86.0 31 104.0 32 143.0 33 194.0 34 249.0 35 345.0 36 522.0 37 617.0 38 696.0 39 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.131773085728824 13.81327906385144 19.053675909437803 45.001271940981944 2 17.7 26.5 36.1 19.7 3 21.4 30.85 25.074999999999996 22.675 4 23.825 32.875 20.150000000000002 23.150000000000002 5 25.624999999999996 34.150000000000006 23.425 16.8 6 18.95 36.95 24.425 19.675 7 15.975 17.275 45.175 21.575 8 20.200000000000003 23.425 28.125 28.249999999999996 9 21.0 23.1 30.95 24.95 10 20.3 38.175 23.674999999999997 17.849999999999998 11 26.950000000000003 26.85 22.275 23.925 12 21.099999999999998 24.925 28.075 25.900000000000002 13 18.25 29.25 31.6 20.9 14 19.55 27.224999999999998 29.875 23.35 15 21.0 28.749999999999996 27.875 22.375 16 20.825 28.349999999999998 27.725 23.1 17 22.05 28.175 27.6 22.175 18 23.0 28.050000000000004 27.474999999999998 21.475 19 22.2 27.474999999999998 27.900000000000002 22.425 20 22.75 28.025 27.025 22.2 21 22.15 27.575 27.900000000000002 22.375 22 20.549999999999997 29.65 27.075 22.725 23 21.349999999999998 29.475 26.6 22.575 24 21.575 27.950000000000003 27.775 22.7 25 21.075 29.25 27.35 22.325 26 20.8 28.9 28.275 22.025 27 21.349999999999998 26.375 29.025000000000002 23.25 28 21.525 28.349999999999998 26.525 23.599999999999998 29 22.0 29.275000000000002 27.175 21.55 30 22.175 27.675 28.15 22.0 31 22.075 25.874999999999996 28.199999999999996 23.849999999999998 32 21.15 29.225 27.975 21.65 33 21.2 27.125 28.249999999999996 23.425 34 21.4 27.725 28.025 22.85 35 21.675 28.175 27.05 23.1 36 21.825 28.975 27.075 22.125 37 22.5 27.800000000000004 27.425 22.275 38 20.925 28.775000000000002 28.349999999999998 21.95 39 21.55 28.4 27.925 22.125 40 21.85 27.925 28.675 21.55 41 21.4 28.575 27.025 23.0 42 21.075 27.500000000000004 28.275 23.150000000000002 43 20.599999999999998 28.325 28.625 22.45 44 21.075 28.625 28.249999999999996 22.05 45 21.525 29.075 27.125 22.275 46 21.325 28.975 27.625 22.075 47 21.275 30.099999999999998 27.025 21.6 48 21.275 29.675 27.725 21.325 49 22.425 26.275 28.875 22.425 50 21.2 27.700000000000003 27.625 23.474999999999998 51 21.725 28.875 26.700000000000003 22.7 52 23.45 28.249999999999996 26.650000000000002 21.65 53 22.400000000000002 27.575 29.15 20.875 54 21.5 28.375 28.325 21.8 55 21.275 29.375 26.150000000000002 23.200000000000003 56 21.875 27.500000000000004 27.650000000000002 22.975 57 21.349999999999998 28.425 28.625 21.6 58 21.3 27.750000000000004 28.275 22.675 59 22.900000000000002 28.175 27.224999999999998 21.7 60 21.4 28.075 27.875 22.650000000000002 61 21.65 28.675 27.450000000000003 22.225 62 20.9 28.725 28.7 21.675 63 22.775000000000002 28.15 27.55 21.525 64 23.175 28.7 27.05 21.075 65 21.95 28.575 27.6 21.875 66 21.2 28.975 28.725 21.099999999999998 67 22.400000000000002 29.849999999999998 26.474999999999998 21.275 68 22.75 28.175 27.525 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 2.5 22 4.0 23 5.0 24 8.0 25 10.0 26 16.0 27 21.0 28 20.0 29 27.0 30 49.5 31 65.0 32 78.5 33 100.5 34 109.0 35 130.0 36 171.0 37 191.0 38 186.5 39 218.5 40 285.5 41 316.0 42 328.5 43 360.0 44 379.0 45 362.5 46 331.5 47 317.0 48 304.5 49 263.5 50 235.0 51 209.0 52 156.0 53 129.0 54 112.5 55 82.0 56 68.0 57 57.5 58 36.5 59 26.0 60 23.0 61 17.5 62 15.0 63 10.5 64 7.5 65 7.5 66 6.0 67 5.0 68 4.5 69 5.0 70 3.5 71 3.0 72 4.0 73 4.0 74 2.0 75 0.0 76 1.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7739829231542 99.325 2 0.20090406830738325 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025113008538422906 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAA 11 0.27499999999999997 TruSeq Adapter, Index 5 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra Read 379918 spots for SRR3207733.sra Written 379918 spots for SRR3207733.sra Read 379904 spots for SRR3207733.sra Written 379904 spots for SRR3207733.sra SRR ids: ['SRR3207733.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9dqq5_o7 SRR3207733.sra spots: 7598094 blocks: [[1, 379904], [379905, 759808], [759809, 1139712], [1139713, 1519616], [1519617, 1899520], [1899521, 2279424], [2279425, 2659328], [2659329, 3039232], [3039233, 3419136], [3419137, 3799040], [3799041, 4178944], [4178945, 4558848], [4558849, 4938752], [4938753, 5318656], [5318657, 5698560], [5698561, 6078464], [6078465, 6458368], [6458369, 6838272], [6838273, 7218176], [7218177, 7598094]] SRR3207733 file size 1595565 SRR3207733 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207733 SRR3207733_1.fastq Input file: SRR3207733_1.fastq trimmed: SRR3207733-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:36:35 2025 >> started Mon Feb 10 17:36:39 2025 >> done (3.781s) 7598094 reads processed; of these: 10135 ( 0.13%) short reads filtered out after trimming by size control 39387 ( 0.52%) empty reads filtered out after trimming by size control 7548572 (99.35%) reads available; of these: 860636 (11.40%) trimmed reads available after processing 6687936 (88.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1521 0.02% 19 2684 0.04% 20 4667 0.06% 21 1645 0.02% 22 2359 0.03% 23 3592 0.05% 24 6401 0.08% 25 10966 0.15% 26 2728 0.04% 27 3529 0.05% 28 4678 0.06% 29 7418 0.10% 30 11243 0.15% 31 3165 0.04% 32 4394 0.06% 33 4849 0.06% 34 7545 0.10% 35 12341 0.16% 36 3686 0.05% 37 4673 0.06% 38 7125 0.09% 39 11700 0.15% 40 19048 0.25% 41 4599 0.06% 42 6733 0.09% 43 9537 0.13% 44 15610 0.21% 45 26564 0.35% 46 6539 0.09% 47 8939 0.12% 48 13330 0.18% 49 21532 0.29% 50 37006 0.49% 51 9213 0.12% 52 11765 0.16% 53 17400 0.23% 54 28872 0.38% 55 48559 0.64% 56 11466 0.15% 57 15927 0.21% 58 24170 0.32% 59 40750 0.54% 60 72278 0.96% 61 15873 0.21% 62 21961 0.29% 63 32656 0.43% 64 53626 0.71% 65 91108 1.21% 66 22524 0.30% 67 50142 0.66% 68 6687936 88.60% 7548572 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=30 prefix-density=0.06 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=160.23 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 17:37:01 Started mapping on | Feb 10 17:37:02 Finished on | Feb 10 17:37:09 Mapping speed, Million of reads per hour | 3882.12 Number of input reads | 7548572 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6916399 Uniquely mapped reads % | 91.63% Average mapped length | 66.50 Number of splices: Total | 1314077 Number of splices: Annotated (sjdb) | 1292910 Number of splices: GT/AG | 1294780 Number of splices: GC/AG | 16026 Number of splices: AT/AC | 1413 Number of splices: Non-canonical | 1858 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237831 % of reads mapped to multiple loci | 3.15% Number of reads mapped to too many loci | 359533 % of reads mapped to too many loci | 4.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 394342 394342 394342 N_multimapping 237831 237831 237831 N_noFeature 325850 3590586 3604604 N_ambiguous 68050 10386 10675 UnstrandedReadsAssigned:6522499 PositiveStrandReadsAssigned:3315427 NegativeStrandReadsAssigned:3301120 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207733 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207733-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,548,572 reads, 6,952,236 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR3207733.ke.tsv 34699 SRR3207733.se.tsv 87100 total ==> SRR3207733.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 155 17.4103 Potri.005G024800.1.v4.1 1035 936 17 3.91492 Potri.004G059700.1.v4.1 961 862 8 2.00047 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 119.324 9.0437 Potri.016G087400.1.v4.1 270 171 199 250.846 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 25 3.2191 Potri.012G127500.1.v4.1 977 878 467 114.649 ==> SRR3207733.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 786 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 125 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207733 completed mapping pipeline successfully