Starting /dee2/code/volunteer_pipeline.sh SRR3207734 current disk space = 3057855881216 free memory = 1250961828 SRR3207734 SRAfilesize 50a37c0a3ab297c8ae0ff8e71675672c SRR3207734.sra SRR3207734.sra file validated SRR3207734 is single end SRR3207734 is conventional basespace SRR3207734 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207734_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.926 38.0 36.0 40.0 33.0 40.0 2 36.50325 38.0 35.0 39.0 31.0 40.0 3 36.50775 38.0 35.0 39.0 31.0 40.0 4 36.55075 38.0 35.0 39.0 31.0 40.0 5 36.6035 38.0 36.0 39.0 31.0 40.0 6 36.55725 38.0 35.0 39.0 31.0 40.0 7 36.53925 38.0 36.0 39.0 31.0 40.0 8 36.41775 38.0 35.0 39.0 31.0 40.0 9 36.4085 38.0 35.0 39.0 31.0 40.0 10 36.3335 38.0 35.0 39.0 30.0 40.0 11 36.422 38.0 35.0 39.0 31.0 40.0 12 36.17675 38.0 35.0 39.0 30.0 40.0 13 36.222 38.0 35.0 39.0 30.0 40.0 14 36.2535 38.0 35.0 39.0 30.0 40.0 15 36.13025 38.0 35.0 39.0 30.0 40.0 16 36.308 38.0 35.0 39.0 30.0 40.0 17 36.033 38.0 35.0 39.0 29.0 40.0 18 36.0565 38.0 35.0 39.0 30.0 40.0 19 35.8895 38.0 35.0 39.0 29.0 40.0 20 35.6365 38.0 35.0 39.0 29.0 40.0 21 35.7605 38.0 35.0 39.0 29.0 40.0 22 35.682 38.0 35.0 39.0 29.0 40.0 23 35.649 38.0 35.0 39.0 29.0 40.0 24 35.51925 38.0 34.0 39.0 29.0 40.0 25 35.2995 38.0 33.0 39.0 29.0 40.0 26 35.02075 38.0 33.0 39.0 28.0 40.0 27 34.9385 38.0 33.0 39.0 27.0 40.0 28 34.86925 38.0 33.0 39.0 27.0 40.0 29 34.69525 38.0 33.0 39.0 27.0 40.0 30 34.71425 38.0 33.0 39.0 27.0 40.0 31 34.915 38.0 34.0 39.0 27.0 40.0 32 34.833 38.0 33.0 39.0 28.0 40.0 33 34.7485 38.0 33.0 39.0 27.0 40.0 34 34.5355 38.0 33.0 39.0 26.0 40.0 35 34.75075 38.0 33.0 39.0 27.0 40.0 36 34.91525 38.0 34.0 39.0 27.0 40.0 37 34.6345 38.0 33.0 39.0 27.0 40.0 38 34.569 38.0 33.0 39.0 27.0 40.0 39 34.45325 37.0 33.0 39.0 27.0 40.0 40 34.4485 38.0 33.0 39.0 27.0 40.0 41 34.3 38.0 33.0 39.0 26.0 40.0 42 34.0105 37.0 33.0 39.0 25.0 40.0 43 33.936 37.0 33.0 39.0 25.0 40.0 44 33.78525 37.0 33.0 39.0 24.0 40.0 45 33.6975 37.0 33.0 39.0 25.0 40.0 46 33.59475 37.0 33.0 39.0 23.0 40.0 47 33.31675 37.0 33.0 39.0 23.0 40.0 48 33.177 36.0 32.0 39.0 23.0 40.0 49 32.99625 36.0 32.0 39.0 23.0 40.0 50 32.77225 36.0 32.0 39.0 23.0 40.0 51 32.668 36.0 32.0 39.0 22.0 40.0 52 32.2365 36.0 31.0 39.0 19.0 39.0 53 32.0425 36.0 31.0 38.0 18.0 39.0 54 31.90125 35.0 31.0 38.0 18.0 39.0 55 31.699 35.0 31.0 38.0 15.0 39.0 56 31.4415 35.0 31.0 38.0 13.0 39.0 57 30.87275 35.0 30.0 38.0 9.0 39.0 58 30.656 35.0 30.0 38.0 2.0 39.0 59 30.565 35.0 29.0 38.0 2.0 39.0 60 30.31575 35.0 29.0 38.0 2.0 39.0 61 30.011 35.0 29.0 38.0 2.0 39.0 62 29.9875 35.0 29.0 38.0 2.0 39.0 63 29.776 34.0 29.0 38.0 2.0 39.0 64 29.33025 34.0 29.0 37.0 2.0 39.0 65 29.01675 34.0 28.0 37.0 2.0 39.0 66 28.65775 33.0 28.0 37.0 2.0 39.0 67 28.35125 33.0 27.0 36.0 2.0 39.0 68 27.72725 33.0 25.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 1.0 5 0.0 6 3.0 7 4.0 8 7.0 9 4.0 10 10.0 11 18.0 12 10.0 13 10.0 14 11.0 15 20.0 16 13.0 17 17.0 18 21.0 19 26.0 20 28.0 21 26.0 22 30.0 23 38.0 24 43.0 25 62.0 26 47.0 27 59.0 28 90.0 29 82.0 30 95.0 31 119.0 32 182.0 33 232.0 34 291.0 35 367.0 36 448.0 37 599.0 38 613.0 39 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.911571500757958 15.664477008590197 18.014148559878727 41.40980293077312 2 19.425 24.8 35.55 20.225 3 21.55 29.575000000000003 26.400000000000002 22.475 4 23.775 34.1 20.95 21.175 5 24.925 36.449999999999996 22.025 16.6 6 17.9 38.3 24.05 19.75 7 14.799999999999999 17.075000000000003 46.675 21.45 8 20.549999999999997 21.425 28.95 29.075 9 20.3 23.974999999999998 30.5 25.224999999999998 10 20.775 39.175 23.65 16.400000000000002 11 25.974999999999998 27.750000000000004 20.724999999999998 25.55 12 20.175 24.175 29.925 25.724999999999998 13 19.375 29.325000000000003 31.474999999999998 19.825 14 20.150000000000002 27.725 30.5 21.625 15 21.65 27.075 28.299999999999997 22.975 16 20.875 27.85 28.9 22.375 17 21.9 28.625 27.875 21.6 18 21.85 29.25 27.375 21.525 19 21.325 27.875 28.599999999999998 22.2 20 22.2 27.775 27.375 22.650000000000002 21 21.7 26.6 28.1 23.599999999999998 22 20.1 28.1 29.2 22.6 23 22.55 29.025000000000002 27.625 20.8 24 20.849999999999998 29.599999999999998 28.000000000000004 21.55 25 20.775 28.999999999999996 27.35 22.875 26 20.875 29.7 27.35 22.075 27 20.825 28.825 27.450000000000003 22.900000000000002 28 21.325 28.7 27.775 22.2 29 22.45 27.875 27.925 21.75 30 21.575 26.775 29.45 22.2 31 21.275 27.025 29.325000000000003 22.375 32 21.25 28.675 28.025 22.05 33 21.25 28.725 27.700000000000003 22.325 34 21.475 27.825 28.175 22.525000000000002 35 22.650000000000002 28.7 26.825 21.825 36 22.6 28.325 28.249999999999996 20.825 37 21.6 29.425 26.974999999999998 22.0 38 21.625 28.499999999999996 28.15 21.725 39 21.9 29.45 27.175 21.475 40 21.45 28.775000000000002 28.1 21.675 41 21.85 28.575 27.575 22.0 42 21.825 28.249999999999996 27.6 22.325 43 21.975 28.749999999999996 27.375 21.9 44 21.275 29.475 28.1 21.15 45 21.625 27.150000000000002 29.325000000000003 21.9 46 21.55 27.575 28.299999999999997 22.575 47 21.825 29.5 26.325 22.35 48 20.974999999999998 28.825 27.325 22.875 49 22.7 28.65 27.474999999999998 21.175 50 22.2 29.299999999999997 26.3 22.2 51 21.775 28.95 27.525 21.75 52 22.400000000000002 28.975 27.525 21.099999999999998 53 22.025 27.750000000000004 28.225 22.0 54 21.875 28.225 27.125 22.775000000000002 55 20.424999999999997 29.65 28.025 21.9 56 22.15 28.225 28.225 21.4 57 22.35 28.225 27.500000000000004 21.925 58 20.974999999999998 29.599999999999998 27.500000000000004 21.925 59 23.1 28.625 27.150000000000002 21.125 60 21.8 27.950000000000003 28.65 21.6 61 22.1 28.125 28.000000000000004 21.775 62 22.375 28.775000000000002 27.325 21.525 63 22.125 27.800000000000004 29.575000000000003 20.5 64 21.75 26.35 29.325000000000003 22.575 65 22.125 27.55 28.775000000000002 21.55 66 21.275 30.2 27.650000000000002 20.875 67 22.400000000000002 27.775 28.425 21.4 68 22.35 28.625 26.950000000000003 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 3.0 23 6.5 24 9.5 25 9.0 26 11.0 27 23.0 28 33.0 29 34.5 30 49.0 31 62.0 32 75.5 33 95.0 34 101.0 35 125.0 36 166.0 37 183.0 38 219.5 39 266.5 40 304.0 41 331.0 42 347.5 43 346.0 44 328.0 45 332.5 46 333.0 47 329.0 48 298.0 49 246.0 50 225.0 51 198.5 52 150.5 53 129.0 54 108.0 55 78.5 56 70.0 57 55.0 58 35.0 59 30.0 60 26.5 61 18.5 62 14.0 63 9.0 64 5.5 65 6.0 66 5.0 67 3.0 68 1.5 69 2.0 70 2.0 71 2.5 72 3.0 73 3.0 74 2.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGATC 15 0.0033427728 62.0 38 GAGAGAT 15 0.0033427728 62.0 37 >>END_MODULE Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260885 spots for SRR3207734.sra Written 260885 spots for SRR3207734.sra Read 260895 spots for SRR3207734.sra Written 260895 spots for SRR3207734.sra SRR ids: ['SRR3207734.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k2up_fb0 SRR3207734.sra spots: 5217710 blocks: [[1, 260885], [260886, 521770], [521771, 782655], [782656, 1043540], [1043541, 1304425], [1304426, 1565310], [1565311, 1826195], [1826196, 2087080], [2087081, 2347965], [2347966, 2608850], [2608851, 2869735], [2869736, 3130620], [3130621, 3391505], [3391506, 3652390], [3652391, 3913275], [3913276, 4174160], [4174161, 4435045], [4435046, 4695930], [4695931, 4956815], [4956816, 5217710]] SRR3207734 file size 1095366 SRR3207734 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207734 SRR3207734_1.fastq Input file: SRR3207734_1.fastq trimmed: SRR3207734-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:49:04 2025 >> started Mon Feb 10 17:49:06 2025 >> done (2.522s) 5217710 reads processed; of these: 8673 ( 0.17%) short reads filtered out after trimming by size control 5123 ( 0.10%) empty reads filtered out after trimming by size control 5203914 (99.74%) reads available; of these: 696398 (13.38%) trimmed reads available after processing 4507516 (86.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1410 0.03% 19 2378 0.05% 20 4002 0.08% 21 1415 0.03% 22 1994 0.04% 23 3058 0.06% 24 5303 0.10% 25 8886 0.17% 26 2380 0.05% 27 2850 0.05% 28 3994 0.08% 29 6186 0.12% 30 9277 0.18% 31 2654 0.05% 32 3535 0.07% 33 4006 0.08% 34 6108 0.12% 35 9672 0.19% 36 2968 0.06% 37 3902 0.07% 38 5756 0.11% 39 9191 0.18% 40 14818 0.28% 41 3993 0.08% 42 5192 0.10% 43 7790 0.15% 44 12929 0.25% 45 20978 0.40% 46 5344 0.10% 47 7288 0.14% 48 10878 0.21% 49 17447 0.34% 50 29306 0.56% 51 7586 0.15% 52 9682 0.19% 53 14418 0.28% 54 23635 0.45% 55 39560 0.76% 56 9794 0.19% 57 13347 0.26% 58 19779 0.38% 59 33858 0.65% 60 57133 1.10% 61 13402 0.26% 62 17924 0.34% 63 26745 0.51% 64 44007 0.85% 65 71429 1.37% 66 18306 0.35% 67 38905 0.75% 68 4507516 86.62% 5203914 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=35 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=100.28 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.2 sequence=CCACCACCAACA Started job on | Feb 10 17:49:24 Started mapping on | Feb 10 17:49:24 Finished on | Feb 10 17:49:30 Mapping speed, Million of reads per hour | 3122.35 Number of input reads | 5203914 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4936141 Uniquely mapped reads % | 94.85% Average mapped length | 66.07 Number of splices: Total | 887349 Number of splices: Annotated (sjdb) | 872915 Number of splices: GT/AG | 874444 Number of splices: GC/AG | 10610 Number of splices: AT/AC | 933 Number of splices: Non-canonical | 1362 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169000 % of reads mapped to multiple loci | 3.25% Number of reads mapped to too many loci | 74716 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 98773 98773 98773 N_multimapping 169000 169000 169000 N_noFeature 234480 2563160 2572169 N_ambiguous 51155 7808 8111 UnstrandedReadsAssigned:4650506 PositiveStrandReadsAssigned:2365173 NegativeStrandReadsAssigned:2355861 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207734 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207734-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,203,914 reads, 4,787,196 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR3207734.ke.tsv 34699 SRR3207734.se.tsv 87100 total ==> SRR3207734.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 136 22.791 Potri.005G024800.1.v4.1 1035 936 19 6.52796 Potri.004G059700.1.v4.1 961 862 7 2.6115 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.7025 7.99475 Potri.016G087400.1.v4.1 270 171 158 297.14 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 21 4.03426 Potri.012G127500.1.v4.1 977 878 243 89.0044 ==> SRR3207734.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 632 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207734 completed mapping pipeline successfully