Starting /dee2/code/volunteer_pipeline.sh SRR3207735 current disk space = 3057968566272 free memory = 1082249624 SRR3207735 SRAfilesize 7a3b02b01c6d5546e7f3d2a4ccd2791d SRR3207735.sra SRR3207735.sra file validated SRR3207735 is single end SRR3207735 is conventional basespace SRR3207735 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207735_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.801 38.0 36.0 40.0 33.0 40.0 2 36.45375 38.0 35.0 40.0 31.0 40.0 3 36.47625 38.0 36.0 40.0 31.0 40.0 4 36.4395 38.0 36.0 39.0 31.0 40.0 5 36.56825 38.0 36.0 40.0 31.0 40.0 6 36.53625 38.0 36.0 39.0 31.0 40.0 7 36.54325 38.0 36.0 40.0 31.0 40.0 8 36.4115 38.0 35.0 39.0 30.0 40.0 9 36.3365 38.0 35.0 40.0 31.0 40.0 10 36.424 38.0 35.0 39.0 31.0 40.0 11 36.601 38.0 35.0 39.0 31.0 40.0 12 36.45575 38.0 35.0 39.0 31.0 40.0 13 36.536 38.0 35.0 39.0 31.0 40.0 14 36.498 38.0 35.0 39.0 31.0 40.0 15 36.3525 38.0 35.0 39.0 31.0 40.0 16 36.4785 38.0 35.0 39.0 31.0 40.0 17 36.227 38.0 35.0 39.0 30.0 40.0 18 36.23375 38.0 35.0 39.0 30.0 40.0 19 36.05775 38.0 35.0 39.0 30.0 40.0 20 35.981 38.0 35.0 39.0 30.0 40.0 21 35.8905 38.0 35.0 39.0 29.0 40.0 22 35.86325 38.0 35.0 39.0 30.0 40.0 23 35.8485 38.0 35.0 39.0 30.0 40.0 24 35.63825 38.0 35.0 39.0 29.0 40.0 25 35.53025 38.0 35.0 39.0 29.0 40.0 26 35.01675 38.0 33.0 39.0 27.0 40.0 27 35.1905 38.0 33.0 39.0 28.0 40.0 28 35.0785 38.0 33.0 39.0 28.0 40.0 29 34.95075 38.0 33.0 39.0 28.0 40.0 30 34.8305 38.0 33.0 39.0 27.0 40.0 31 34.90675 38.0 33.0 39.0 27.0 40.0 32 34.8435 38.0 33.0 39.0 27.0 40.0 33 34.879 38.0 33.0 39.0 28.0 40.0 34 34.62825 38.0 33.0 39.0 27.0 40.0 35 34.741 38.0 33.0 39.0 27.0 40.0 36 34.91275 38.0 34.0 39.0 28.0 40.0 37 34.6965 38.0 33.0 39.0 27.0 40.0 38 34.5475 37.0 33.0 39.0 27.0 40.0 39 34.52575 37.0 33.0 39.0 27.0 40.0 40 34.387 37.0 33.0 39.0 27.0 40.0 41 34.33875 38.0 33.0 39.0 26.0 40.0 42 34.1465 37.0 33.0 39.0 26.0 40.0 43 34.00875 37.0 33.0 39.0 26.0 40.0 44 33.86925 37.0 33.0 39.0 26.0 40.0 45 33.7475 37.0 33.0 39.0 25.0 40.0 46 33.61625 36.0 33.0 39.0 25.0 40.0 47 33.2895 36.0 33.0 39.0 23.0 40.0 48 33.07525 36.0 32.0 39.0 23.0 40.0 49 32.84625 36.0 32.0 39.0 23.0 39.0 50 32.59875 36.0 32.0 39.0 22.0 39.0 51 32.34675 36.0 31.0 39.0 19.0 39.0 52 31.828 35.0 31.0 38.0 18.0 39.0 53 31.698 35.0 31.0 38.0 17.0 39.0 54 31.60075 35.0 31.0 38.0 18.0 39.0 55 31.5145 35.0 31.0 38.0 17.0 39.0 56 31.2265 35.0 30.0 38.0 11.0 39.0 57 30.76775 35.0 30.0 38.0 9.0 39.0 58 30.50225 35.0 29.0 38.0 2.0 39.0 59 30.5235 35.0 29.0 38.0 2.0 39.0 60 29.99425 34.0 29.0 37.0 2.0 39.0 61 29.686 34.0 29.0 37.0 2.0 39.0 62 29.443 34.0 29.0 37.0 2.0 39.0 63 29.396 34.0 29.0 37.0 2.0 39.0 64 28.77525 33.0 28.0 36.0 2.0 39.0 65 28.40325 33.0 27.0 36.0 2.0 39.0 66 28.02475 33.0 27.0 36.0 2.0 39.0 67 27.89075 33.0 27.0 36.0 2.0 39.0 68 27.2315 33.0 24.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 0.0 4 0.0 5 1.0 6 2.0 7 5.0 8 4.0 9 4.0 10 6.0 11 6.0 12 14.0 13 14.0 14 16.0 15 11.0 16 15.0 17 17.0 18 16.0 19 30.0 20 23.0 21 34.0 22 46.0 23 40.0 24 38.0 25 53.0 26 56.0 27 71.0 28 77.0 29 95.0 30 102.0 31 123.0 32 181.0 33 245.0 34 276.0 35 341.0 36 507.0 37 596.0 38 580.0 39 340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.931841302136316 15.361139369277721 19.303153611393693 41.40386571719227 2 18.3 25.825 36.425000000000004 19.45 3 22.400000000000002 29.575000000000003 25.650000000000002 22.375 4 24.0 34.35 20.45 21.2 5 24.349999999999998 35.425000000000004 22.6 17.625 6 17.175 38.35 24.4 20.075000000000003 7 15.15 16.725 46.825 21.3 8 19.375 22.7 28.599999999999998 29.325000000000003 9 19.4048512128032 22.83070767691923 30.15753938484621 27.60690172543136 10 19.525000000000002 39.025 23.400000000000002 18.05 11 25.874999999999996 26.35 21.275 26.5 12 21.425 24.45 28.9 25.224999999999998 13 18.925 28.349999999999998 30.175 22.55 14 18.6 29.15 29.7 22.55 15 20.4 28.275 27.925 23.400000000000002 16 21.224999999999998 28.499999999999996 27.575 22.7 17 21.55 28.299999999999997 26.950000000000003 23.200000000000003 18 20.325 29.625 27.825 22.225 19 21.75 27.975 27.875 22.400000000000002 20 22.15 27.375 27.950000000000003 22.525000000000002 21 20.875 27.900000000000002 28.875 22.35 22 23.05 29.075 25.75 22.125 23 21.95 28.299999999999997 27.55 22.2 24 21.125 29.25 27.675 21.95 25 22.05 28.075 27.474999999999998 22.400000000000002 26 20.875 29.225 28.349999999999998 21.55 27 21.875 28.425 28.000000000000004 21.7 28 21.5 27.200000000000003 28.975 22.325 29 21.05 29.575000000000003 27.125 22.25 30 20.9 28.325 28.275 22.5 31 20.474999999999998 27.525 28.975 23.025000000000002 32 20.724999999999998 28.1 28.075 23.1 33 21.75 28.725 26.900000000000002 22.625 34 21.475 27.650000000000002 28.499999999999996 22.375 35 20.825 29.2 28.000000000000004 21.975 36 20.655163790947736 29.28232058014504 26.806701675418854 23.25581395348837 37 21.95 28.15 27.55 22.35 38 21.525 29.025000000000002 27.175 22.275 39 22.1055263815954 28.482120530132534 27.506876719179797 21.905476369092273 40 22.725 27.0 28.375 21.9 41 21.7 28.125 27.3 22.875 42 20.95 28.749999999999996 28.849999999999998 21.45 43 21.349999999999998 28.225 27.275 23.150000000000002 44 21.125 28.000000000000004 27.925 22.95 45 21.325 29.275000000000002 27.6 21.8 46 21.65 28.825 27.3 22.225 47 23.549999999999997 28.075 27.575 20.8 48 20.599999999999998 28.975 29.45 20.974999999999998 49 21.775 27.6 28.1 22.525000000000002 50 22.725 28.249999999999996 27.3 21.725 51 22.525000000000002 28.1 27.750000000000004 21.625 52 20.9 28.549999999999997 29.125 21.425 53 21.825 28.050000000000004 27.925 22.2 54 21.0 28.075 28.599999999999998 22.325 55 21.25 28.475 26.950000000000003 23.325000000000003 56 21.95 27.675 28.15 22.225 57 22.325 27.800000000000004 27.55 22.325 58 21.325 28.325 27.474999999999998 22.875 59 21.8 28.925 27.325 21.95 60 22.8 28.775000000000002 27.575 20.849999999999998 61 21.875 28.025 27.525 22.575 62 20.349999999999998 28.575 27.875 23.200000000000003 63 22.625 27.3 28.275 21.8 64 22.380595148787197 27.481870467616904 28.557139284821204 21.580395098774694 65 22.75 27.474999999999998 27.200000000000003 22.575 66 20.95 28.749999999999996 27.85 22.45 67 21.875 27.950000000000003 27.825 22.35 68 21.625 29.175 28.499999999999996 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.0 20 2.5 21 3.5 22 5.0 23 5.5 24 9.0 25 12.0 26 17.5 27 31.0 28 39.0 29 43.0 30 50.0 31 53.0 32 65.0 33 90.5 34 104.0 35 123.0 36 170.5 37 199.0 38 199.0 39 235.5 40 299.0 41 326.0 42 323.0 43 338.5 44 357.0 45 351.0 46 334.5 47 324.0 48 309.0 49 262.5 50 231.0 51 197.5 52 145.5 53 127.0 54 113.0 55 82.5 56 66.0 57 58.0 58 41.5 59 33.0 60 31.0 61 18.0 62 7.0 63 9.5 64 9.0 65 6.5 66 7.0 67 5.5 68 4.5 69 5.0 70 4.5 71 3.0 72 2.0 73 1.0 74 0.5 75 1.0 76 0.5 77 1.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.025 37 0.0 38 0.0 39 0.025 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376214 spots for SRR3207735.sra Written 376214 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra Read 376205 spots for SRR3207735.sra Written 376205 spots for SRR3207735.sra SRR ids: ['SRR3207735.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cqh7_8gy SRR3207735.sra spots: 7524109 blocks: [[1, 376205], [376206, 752410], [752411, 1128615], [1128616, 1504820], [1504821, 1881025], [1881026, 2257230], [2257231, 2633435], [2633436, 3009640], [3009641, 3385845], [3385846, 3762050], [3762051, 4138255], [4138256, 4514460], [4514461, 4890665], [4890666, 5266870], [5266871, 5643075], [5643076, 6019280], [6019281, 6395485], [6395486, 6771690], [6771691, 7147895], [7147896, 7524109]] SRR3207735 file size 1580031 SRR3207735 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207735 SRR3207735_1.fastq Input file: SRR3207735_1.fastq trimmed: SRR3207735-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:52:05 2025 >> started Mon Feb 10 17:52:09 2025 >> done (3.495s) 7524109 reads processed; of these: 13006 ( 0.17%) short reads filtered out after trimming by size control 14361 ( 0.19%) empty reads filtered out after trimming by size control 7496742 (99.64%) reads available; of these: 1020046 (13.61%) trimmed reads available after processing 6476696 (86.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2062 0.03% 19 3588 0.05% 20 6085 0.08% 21 1980 0.03% 22 2895 0.04% 23 4574 0.06% 24 7715 0.10% 25 12994 0.17% 26 3428 0.05% 27 4331 0.06% 28 5822 0.08% 29 9120 0.12% 30 13843 0.18% 31 3912 0.05% 32 5372 0.07% 33 5968 0.08% 34 9217 0.12% 35 14380 0.19% 36 4497 0.06% 37 5757 0.08% 38 8378 0.11% 39 13788 0.18% 40 22000 0.29% 41 5763 0.08% 42 7840 0.10% 43 11331 0.15% 44 18912 0.25% 45 30902 0.41% 46 7914 0.11% 47 10892 0.15% 48 16119 0.22% 49 25904 0.35% 50 43242 0.58% 51 10724 0.14% 52 14338 0.19% 53 20948 0.28% 54 34764 0.46% 55 57925 0.77% 56 14374 0.19% 57 19564 0.26% 58 28730 0.38% 59 49305 0.66% 60 83570 1.11% 61 19468 0.26% 62 26217 0.35% 63 38592 0.51% 64 63712 0.85% 65 104666 1.40% 66 26585 0.35% 67 56039 0.75% 68 6476696 86.39% 7496742 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=33 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=162.25 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=19.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 17:52:33 Started mapping on | Feb 10 17:52:36 Finished on | Feb 10 17:52:43 Mapping speed, Million of reads per hour | 3855.47 Number of input reads | 7496742 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 7115388 Uniquely mapped reads % | 94.91% Average mapped length | 66.01 Number of splices: Total | 1317224 Number of splices: Annotated (sjdb) | 1296697 Number of splices: GT/AG | 1297875 Number of splices: GC/AG | 16033 Number of splices: AT/AC | 1378 Number of splices: Non-canonical | 1938 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251024 % of reads mapped to multiple loci | 3.35% Number of reads mapped to too many loci | 92974 % of reads mapped to too many loci | 1.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 130330 130330 130330 N_multimapping 251024 251024 251024 N_noFeature 306343 3686140 3689282 N_ambiguous 67472 10586 10656 UnstrandedReadsAssigned:6741573 PositiveStrandReadsAssigned:3418662 NegativeStrandReadsAssigned:3415450 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207735 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207735-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,496,742 reads, 6,924,969 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR3207735.ke.tsv 34699 SRR3207735.se.tsv 87100 total ==> SRR3207735.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 173 19.224 Potri.005G024800.1.v4.1 1035 936 39 8.88506 Potri.004G059700.1.v4.1 961 862 1 0.24738 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 101.026 7.57484 Potri.016G087400.1.v4.1 270 171 263 327.968 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 26 3.31199 Potri.012G127500.1.v4.1 977 878 850 206.441 ==> SRR3207735.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 676 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 122 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207735 completed mapping pipeline successfully