Starting /dee2/code/volunteer_pipeline.sh SRR3207736 current disk space = 3057398697984 free memory = 1571500652 SRR3207736 SRAfilesize da5ceea10d91e25c9baa43e18f73bca1 SRR3207736.sra SRR3207736.sra file validated SRR3207736 is single end SRR3207736 is conventional basespace SRR3207736 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207736_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.236 38.0 36.0 39.0 31.0 40.0 2 36.051 38.0 35.0 39.0 30.0 40.0 3 36.089 38.0 35.0 39.0 30.0 40.0 4 36.033 38.0 35.0 39.0 30.0 40.0 5 36.03925 38.0 36.0 39.0 30.0 40.0 6 36.15875 38.0 35.0 39.0 30.0 40.0 7 36.139 38.0 35.0 39.0 30.0 40.0 8 36.0855 38.0 35.0 39.0 30.0 40.0 9 36.00925 38.0 35.0 39.0 29.0 40.0 10 36.06425 38.0 35.0 39.0 30.0 40.0 11 36.35 38.0 35.0 39.0 31.0 40.0 12 36.31075 38.0 35.0 39.0 31.0 40.0 13 36.303 38.0 35.0 39.0 31.0 40.0 14 36.1825 38.0 35.0 39.0 31.0 40.0 15 36.1275 38.0 35.0 39.0 30.0 40.0 16 36.159 38.0 35.0 39.0 31.0 40.0 17 35.89025 38.0 35.0 39.0 30.0 40.0 18 35.9375 38.0 35.0 39.0 30.0 40.0 19 35.747 38.0 35.0 39.0 29.0 40.0 20 35.61325 38.0 35.0 39.0 29.0 40.0 21 35.611 38.0 35.0 39.0 29.0 40.0 22 35.60825 38.0 35.0 39.0 29.0 40.0 23 35.4605 38.0 34.0 39.0 29.0 40.0 24 35.3905 38.0 34.0 39.0 29.0 40.0 25 35.291 38.0 33.0 39.0 29.0 40.0 26 34.9345 38.0 33.0 39.0 27.0 40.0 27 34.93825 38.0 33.0 39.0 28.0 40.0 28 34.8095 38.0 33.0 39.0 28.0 40.0 29 34.481 38.0 33.0 39.0 27.0 40.0 30 34.50075 38.0 33.0 39.0 27.0 40.0 31 34.63825 38.0 33.0 39.0 27.0 40.0 32 34.47675 38.0 33.0 39.0 27.0 40.0 33 34.41825 38.0 33.0 39.0 27.0 40.0 34 34.22725 37.0 33.0 39.0 26.0 40.0 35 34.36375 38.0 33.0 39.0 27.0 40.0 36 34.7105 38.0 33.0 39.0 28.0 40.0 37 34.47475 38.0 33.0 39.0 27.0 40.0 38 34.38675 37.0 33.0 39.0 27.0 40.0 39 34.23575 37.0 33.0 39.0 27.0 40.0 40 34.15575 37.0 33.0 39.0 27.0 40.0 41 33.92775 37.0 33.0 39.0 25.0 40.0 42 33.69125 37.0 33.0 39.0 24.0 40.0 43 33.71075 37.0 33.0 39.0 25.0 40.0 44 33.5615 36.0 33.0 39.0 24.0 40.0 45 33.28425 36.0 32.0 39.0 23.0 40.0 46 33.0625 36.0 32.0 39.0 23.0 40.0 47 32.6955 36.0 32.0 39.0 22.0 40.0 48 32.577 36.0 31.0 39.0 22.0 39.0 49 32.44625 36.0 31.0 39.0 21.0 39.0 50 32.16575 36.0 31.0 38.0 19.0 39.0 51 31.87175 36.0 31.0 38.0 17.0 39.0 52 31.3985 35.0 31.0 38.0 15.0 39.0 53 31.17925 35.0 30.0 38.0 15.0 39.0 54 31.059 35.0 30.0 38.0 11.0 39.0 55 30.964 35.0 31.0 38.0 4.0 39.0 56 30.61275 35.0 30.0 38.0 2.0 39.0 57 30.126 34.0 29.0 38.0 2.0 39.0 58 29.94725 34.0 29.0 37.0 2.0 39.0 59 29.77575 34.0 29.0 37.0 2.0 39.0 60 29.368 33.0 29.0 37.0 2.0 39.0 61 29.012 33.0 28.0 37.0 2.0 39.0 62 28.9645 34.0 29.0 37.0 2.0 39.0 63 28.80175 33.0 28.0 37.0 2.0 39.0 64 28.19475 33.0 27.0 36.0 2.0 39.0 65 27.6695 33.0 26.0 36.0 2.0 38.0 66 27.351 33.0 25.0 36.0 2.0 38.0 67 26.8985 33.0 23.0 36.0 2.0 38.0 68 26.37975 32.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 0.0 4 1.0 5 3.0 6 3.0 7 3.0 8 2.0 9 5.0 10 13.0 11 7.0 12 9.0 13 13.0 14 16.0 15 21.0 16 12.0 17 20.0 18 16.0 19 30.0 20 35.0 21 31.0 22 34.0 23 43.0 24 52.0 25 64.0 26 73.0 27 81.0 28 77.0 29 88.0 30 102.0 31 143.0 32 181.0 33 219.0 34 260.0 35 372.0 36 470.0 37 616.0 38 592.0 39 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.206825232678387 16.08066184074457 18.536711478800413 40.17580144777663 2 18.2 26.35 36.325 19.125 3 21.8 30.325000000000003 25.974999999999998 21.9 4 25.275 34.175 20.599999999999998 19.950000000000003 5 24.425 35.65 23.45 16.475 6 18.05 38.95 24.375 18.625 7 16.2 16.8 45.375 21.625 8 19.975 23.674999999999997 28.875 27.474999999999998 9 19.0 23.125 33.1 24.775 10 19.525000000000002 39.7 23.925 16.85 11 25.724999999999998 29.825000000000003 20.674999999999997 23.775 12 19.775000000000002 24.75 29.825000000000003 25.650000000000002 13 19.925 28.675 30.275000000000002 21.125 14 19.875 28.449999999999996 29.599999999999998 22.075 15 21.3 28.575 26.875 23.25 16 21.099999999999998 28.975 27.400000000000002 22.525000000000002 17 21.9 28.325 27.575 22.2 18 21.6 29.4 27.725 21.275 19 21.85 27.35 29.299999999999997 21.5 20 21.4 29.049999999999997 27.05 22.5 21 20.25 30.0 27.900000000000002 21.85 22 21.55 29.15 27.500000000000004 21.8 23 21.525 29.675 27.3 21.5 24 20.5 29.675 27.675 22.15 25 22.25 28.325 27.1 22.325 26 20.825 30.15 26.924999999999997 22.1 27 20.825 29.425 27.950000000000003 21.8 28 20.75 27.425 27.85 23.974999999999998 29 22.400000000000002 30.075000000000003 26.224999999999998 21.3 30 21.2 28.999999999999996 27.650000000000002 22.15 31 21.6 30.175 26.674999999999997 21.55 32 20.625 28.825 28.299999999999997 22.25 33 21.9 26.924999999999997 29.025000000000002 22.15 34 21.725 28.475 27.700000000000003 22.1 35 22.05 28.775000000000002 27.575 21.6 36 21.4 29.825000000000003 27.925 20.849999999999998 37 22.25 28.749999999999996 27.275 21.725 38 20.974999999999998 30.325000000000003 28.275 20.424999999999997 39 22.175 27.900000000000002 27.425 22.5 40 22.400000000000002 27.35 28.000000000000004 22.25 41 22.125 29.525000000000002 27.450000000000003 20.9 42 21.275 28.4 29.299999999999997 21.025 43 21.099999999999998 27.85 28.425 22.625 44 22.35 29.299999999999997 26.525 21.825 45 21.525 28.425 28.375 21.675 46 21.525 28.225 28.199999999999996 22.05 47 22.175 29.549999999999997 27.175 21.099999999999998 48 22.525000000000002 28.225 27.85 21.4 49 20.674999999999997 29.45 28.225 21.65 50 21.825 29.599999999999998 28.449999999999996 20.125 51 21.125 28.449999999999996 28.725 21.7 52 22.1 28.299999999999997 27.150000000000002 22.45 53 20.974999999999998 28.799999999999997 27.875 22.35 54 21.45 28.549999999999997 28.875 21.125 55 21.8 27.325 29.125 21.75 56 22.075 27.3 28.825 21.8 57 21.775 27.85 28.9 21.475 58 20.625 29.325000000000003 28.475 21.575 59 22.15 28.625 27.474999999999998 21.75 60 22.25 27.500000000000004 27.775 22.475 61 21.75 28.825 28.050000000000004 21.375 62 22.6 28.925 26.474999999999998 22.0 63 22.725 28.15 27.525 21.6 64 23.075000000000003 27.200000000000003 27.875 21.85 65 21.25 28.95 29.099999999999998 20.7 66 22.225 28.249999999999996 27.35 22.175 67 21.925 27.474999999999998 29.225 21.375 68 23.075000000000003 28.549999999999997 27.0 21.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 2.0 20 3.0 21 5.5 22 7.0 23 9.5 24 14.5 25 17.0 26 16.0 27 25.5 28 36.0 29 37.0 30 57.0 31 76.0 32 83.5 33 100.5 34 110.0 35 132.0 36 180.0 37 206.0 38 230.0 39 253.0 40 306.5 41 361.0 42 353.5 43 355.0 44 364.0 45 333.5 46 304.5 47 306.0 48 285.0 49 238.0 50 212.0 51 187.5 52 137.0 53 111.0 54 96.0 55 73.0 56 65.0 57 50.5 58 33.0 59 30.0 60 24.5 61 19.5 62 20.0 63 17.0 64 10.5 65 5.0 66 3.0 67 4.5 68 3.5 69 1.0 70 3.5 71 4.0 72 2.0 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721551 spots for SRR3207736.sra Written 721551 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra Read 721534 spots for SRR3207736.sra Written 721534 spots for SRR3207736.sra SRR ids: ['SRR3207736.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2izuwvcm SRR3207736.sra spots: 14430697 blocks: [[1, 721534], [721535, 1443068], [1443069, 2164602], [2164603, 2886136], [2886137, 3607670], [3607671, 4329204], [4329205, 5050738], [5050739, 5772272], [5772273, 6493806], [6493807, 7215340], [7215341, 7936874], [7936875, 8658408], [8658409, 9379942], [9379943, 10101476], [10101477, 10823010], [10823011, 11544544], [11544545, 12266078], [12266079, 12987612], [12987613, 13709146], [13709147, 14430697]] SRR3207736 file size 3035711 SRR3207736 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207736 SRR3207736_1.fastq Input file: SRR3207736_1.fastq trimmed: SRR3207736-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:37:24 2025 >> started Mon Feb 10 18:37:31 2025 >> done (7.126s) 14430697 reads processed; of these: 23624 ( 0.16%) short reads filtered out after trimming by size control 16159 ( 0.11%) empty reads filtered out after trimming by size control 14390914 (99.72%) reads available; of these: 1884034 (13.09%) trimmed reads available after processing 12506880 (86.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3725 0.03% 19 6428 0.04% 20 11188 0.08% 21 3792 0.03% 22 5425 0.04% 23 8348 0.06% 24 14319 0.10% 25 24722 0.17% 26 6130 0.04% 27 7837 0.05% 28 10663 0.07% 29 16642 0.12% 30 25496 0.18% 31 7290 0.05% 32 9790 0.07% 33 10865 0.08% 34 16586 0.12% 35 26334 0.18% 36 8154 0.06% 37 10660 0.07% 38 15754 0.11% 39 25074 0.17% 40 40565 0.28% 41 10358 0.07% 42 14159 0.10% 43 20854 0.14% 44 34391 0.24% 45 56681 0.39% 46 14339 0.10% 47 19729 0.14% 48 28914 0.20% 49 47139 0.33% 50 79370 0.55% 51 19918 0.14% 52 25845 0.18% 53 38544 0.27% 54 63453 0.44% 55 107316 0.75% 56 26345 0.18% 57 35661 0.25% 58 52969 0.37% 59 90739 0.63% 60 155850 1.08% 61 35625 0.25% 62 48104 0.33% 63 71825 0.50% 64 119039 0.83% 65 195231 1.36% 66 49042 0.34% 67 106807 0.74% 68 12506880 86.91% 14390914 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=37 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=130.09 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.8 sequence=TTCTTCTTCTTT Started job on | Feb 10 18:37:44 Started mapping on | Feb 10 18:37:45 Finished on | Feb 10 18:37:56 Mapping speed, Million of reads per hour | 4709.75 Number of input reads | 14390914 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 13692610 Uniquely mapped reads % | 95.15% Average mapped length | 66.08 Number of splices: Total | 2459567 Number of splices: Annotated (sjdb) | 2419398 Number of splices: GT/AG | 2423929 Number of splices: GC/AG | 29473 Number of splices: AT/AC | 2531 Number of splices: Non-canonical | 3634 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469379 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 159536 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 228925 228925 228925 N_multimapping 469379 469379 469379 N_noFeature 652975 7123601 7127333 N_ambiguous 137578 21261 21832 UnstrandedReadsAssigned:12902057 PositiveStrandReadsAssigned:6547748 NegativeStrandReadsAssigned:6543445 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207736 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207736-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,390,914 reads, 13,237,759 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR3207736.ke.tsv 34699 SRR3207736.se.tsv 87100 total ==> SRR3207736.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 392 23.2764 Potri.005G024800.1.v4.1 1035 936 101 12.2956 Potri.004G059700.1.v4.1 961 862 14 1.85065 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 197.175 7.9 Potri.016G087400.1.v4.1 270 171 534.614 356.245 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 64.9896 4.42377 Potri.012G127500.1.v4.1 977 878 1014 131.598 ==> SRR3207736.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1834 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207736 completed mapping pipeline successfully