Starting /dee2/code/volunteer_pipeline.sh SRR3207737 current disk space = 3057913655296 free memory = 1145028760 SRR3207737 SRAfilesize 90fe0d98c8653ee7623f89b8a4d7f961 SRR3207737.sra SRR3207737.sra file validated SRR3207737 is single end SRR3207737 is conventional basespace SRR3207737 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207737_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.5645 39.0 38.0 40.0 33.0 40.0 2 37.32925 39.0 37.0 40.0 33.0 40.0 3 37.20775 39.0 37.0 40.0 33.0 40.0 4 37.29625 39.0 38.0 40.0 33.0 40.0 5 37.2275 39.0 37.0 40.0 33.0 40.0 6 37.21375 39.0 37.0 40.0 33.0 40.0 7 37.2775 39.0 37.0 40.0 33.0 40.0 8 37.19375 39.0 36.0 40.0 33.0 40.0 9 37.07375 39.0 36.0 40.0 33.0 40.0 10 37.1195 39.0 36.0 40.0 33.0 40.0 11 37.225 39.0 36.0 40.0 33.0 40.0 12 37.0 39.0 36.0 40.0 33.0 40.0 13 36.97 39.0 36.0 40.0 31.0 40.0 14 37.00775 39.0 36.0 40.0 32.0 40.0 15 36.785 38.0 36.0 40.0 31.0 40.0 16 36.83025 38.0 36.0 40.0 32.0 40.0 17 36.76225 38.0 36.0 40.0 31.0 40.0 18 36.768 38.0 36.0 40.0 31.0 40.0 19 36.713 38.0 36.0 40.0 31.0 40.0 20 36.60325 38.0 35.0 40.0 31.0 40.0 21 36.56825 38.0 36.0 40.0 31.0 40.0 22 36.43425 38.0 35.0 40.0 31.0 40.0 23 36.3255 38.0 35.0 40.0 30.0 40.0 24 36.16175 38.0 35.0 40.0 30.0 40.0 25 36.141 38.0 35.0 39.0 30.0 40.0 26 35.81475 38.0 35.0 39.0 30.0 40.0 27 35.816 38.0 35.0 39.0 29.0 40.0 28 35.669 38.0 35.0 39.0 29.0 40.0 29 35.526 38.0 35.0 39.0 29.0 40.0 30 35.39675 38.0 34.0 39.0 29.0 40.0 31 35.69075 38.0 35.0 39.0 29.0 40.0 32 35.57675 38.0 35.0 39.0 29.0 40.0 33 35.66325 38.0 35.0 39.0 29.0 40.0 34 35.537 38.0 35.0 39.0 29.0 40.0 35 35.46025 38.0 35.0 39.0 29.0 40.0 36 35.628 38.0 35.0 39.0 29.0 40.0 37 35.373 38.0 35.0 39.0 29.0 40.0 38 35.30725 38.0 35.0 39.0 29.0 40.0 39 35.12775 38.0 34.0 39.0 28.0 40.0 40 35.159 38.0 34.0 39.0 29.0 40.0 41 35.0495 38.0 35.0 39.0 28.0 40.0 42 34.9655 38.0 34.0 39.0 28.0 40.0 43 34.91625 38.0 33.0 39.0 28.0 40.0 44 34.74275 38.0 33.0 39.0 28.0 40.0 45 34.6945 38.0 33.0 39.0 28.0 40.0 46 34.447 38.0 33.0 39.0 27.0 40.0 47 34.26825 37.0 33.0 39.0 26.0 40.0 48 34.069 37.0 33.0 39.0 26.0 40.0 49 33.6045 36.0 33.0 39.0 24.0 40.0 50 33.684 37.0 33.0 39.0 25.0 40.0 51 33.4715 36.0 33.0 39.0 23.0 40.0 52 33.4015 36.0 33.0 39.0 23.0 40.0 53 33.15175 36.0 33.0 39.0 23.0 40.0 54 32.9315 36.0 32.0 39.0 23.0 40.0 55 32.74125 36.0 32.0 39.0 23.0 40.0 56 32.78825 36.0 32.0 39.0 23.0 39.0 57 32.248 36.0 31.0 38.0 18.0 39.0 58 32.1745 36.0 31.0 38.0 20.0 39.0 59 32.0135 35.0 31.0 38.0 19.0 39.0 60 31.802 35.0 31.0 38.0 18.0 39.0 61 31.538 35.0 31.0 38.0 12.0 39.0 62 31.27925 35.0 31.0 38.0 10.0 39.0 63 31.0115 35.0 31.0 38.0 2.0 39.0 64 30.592 35.0 30.0 38.0 2.0 39.0 65 30.42725 35.0 30.0 38.0 2.0 39.0 66 29.9575 34.0 29.0 38.0 2.0 39.0 67 29.797 34.0 29.0 37.0 2.0 39.0 68 29.08275 33.0 28.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 1.0 6 1.0 7 2.0 8 1.0 9 3.0 10 9.0 11 6.0 12 19.0 13 14.0 14 7.0 15 15.0 16 12.0 17 19.0 18 16.0 19 8.0 20 18.0 21 19.0 22 20.0 23 29.0 24 27.0 25 46.0 26 40.0 27 57.0 28 74.0 29 74.0 30 75.0 31 117.0 32 162.0 33 170.0 34 239.0 35 350.0 36 450.0 37 610.0 38 762.0 39 521.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.41645633518425 14.386673397274105 18.34931852599697 41.84755174154468 2 18.45 25.275 36.225 20.05 3 22.875 28.625 25.924999999999997 22.575 4 23.1 34.925 20.200000000000003 21.775 5 24.725 34.300000000000004 23.275000000000002 17.7 6 17.05 37.55 25.324999999999996 20.075000000000003 7 15.875 16.75 45.725 21.65 8 19.975 22.025 30.125 27.875 9 20.0 23.325000000000003 31.525 25.15 10 20.45 38.375 22.775000000000002 18.4 11 25.900000000000002 27.975 19.950000000000003 26.174999999999997 12 20.849999999999998 24.0 29.75 25.4 13 19.45 28.050000000000004 31.0 21.5 14 21.075 26.950000000000003 29.375 22.6 15 20.549999999999997 27.800000000000004 28.849999999999998 22.8 16 21.725 29.325000000000003 26.674999999999997 22.275 17 22.425 28.275 28.475 20.825 18 21.05 27.950000000000003 28.199999999999996 22.8 19 21.4 28.050000000000004 28.999999999999996 21.55 20 22.45 28.825 27.05 21.675 21 21.975 27.500000000000004 28.425 22.1 22 20.474999999999998 28.175 28.749999999999996 22.6 23 22.625 29.099999999999998 26.400000000000002 21.875 24 22.900000000000002 27.900000000000002 26.900000000000002 22.3 25 20.325 29.275000000000002 27.750000000000004 22.650000000000002 26 21.675 28.349999999999998 27.975 22.0 27 21.2 28.050000000000004 28.249999999999996 22.5 28 20.95 27.975 28.775000000000002 22.3 29 21.075 27.3 28.4 23.225 30 20.95 28.325 28.599999999999998 22.125 31 21.025 27.800000000000004 28.525 22.650000000000002 32 21.9 28.225 28.125 21.75 33 22.625 28.125 27.025 22.225 34 22.075 28.7 27.450000000000003 21.775 35 21.375 27.0 27.800000000000004 23.825 36 21.0 29.225 28.000000000000004 21.775 37 20.549999999999997 29.349999999999998 27.450000000000003 22.650000000000002 38 22.925 28.075 26.400000000000002 22.6 39 21.725 28.199999999999996 28.175 21.9 40 21.9 27.150000000000002 28.349999999999998 22.6 41 20.925 29.375 28.225 21.475 42 20.474999999999998 28.549999999999997 28.125 22.85 43 20.275000000000002 28.275 28.125 23.325000000000003 44 21.175 27.05 28.625 23.150000000000002 45 21.349999999999998 28.799999999999997 28.15 21.7 46 21.675 29.225 27.775 21.325 47 21.9 27.250000000000004 28.849999999999998 22.0 48 22.25 27.875 27.800000000000004 22.075 49 20.9 28.975 27.800000000000004 22.325 50 21.099999999999998 29.325000000000003 28.000000000000004 21.575 51 21.125 29.225 27.175 22.475 52 21.675 27.474999999999998 27.925 22.925 53 21.3 28.4 28.575 21.725 54 23.0 27.400000000000002 27.750000000000004 21.85 55 21.099999999999998 28.799999999999997 27.175 22.925 56 23.025000000000002 26.875 28.849999999999998 21.25 57 22.575 28.1 26.85 22.475 58 21.8 28.749999999999996 27.425 22.025 59 21.8 28.475 28.375 21.349999999999998 60 21.25 28.000000000000004 30.049999999999997 20.7 61 22.225 28.175 27.450000000000003 22.15 62 22.35 27.500000000000004 27.85 22.3 63 21.825 28.4 27.900000000000002 21.875 64 21.65 28.299999999999997 28.1 21.95 65 22.650000000000002 27.1 27.950000000000003 22.3 66 22.1 29.075 27.675 21.15 67 22.15 28.125 27.0 22.725 68 23.05 27.500000000000004 26.974999999999998 22.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.5 18 2.5 19 2.0 20 1.5 21 3.5 22 6.0 23 6.0 24 8.5 25 11.0 26 13.5 27 25.5 28 35.0 29 33.5 30 44.0 31 56.0 32 66.5 33 85.0 34 93.0 35 121.0 36 169.0 37 189.0 38 213.0 39 255.0 40 299.5 41 326.0 42 343.5 43 358.0 44 355.0 45 335.0 46 305.0 47 295.0 48 288.0 49 246.0 50 211.0 51 207.0 52 166.5 53 130.0 54 117.5 55 85.5 56 66.0 57 58.5 58 39.5 59 28.0 60 25.5 61 20.0 62 17.0 63 17.5 64 13.0 65 5.0 66 2.0 67 5.0 68 5.0 69 2.0 70 1.5 71 1.0 72 1.0 73 1.5 74 1.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225009 spots for SRR3207737.sra Written 225009 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra Read 225005 spots for SRR3207737.sra Written 225005 spots for SRR3207737.sra SRR ids: ['SRR3207737.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kpamxsrt SRR3207737.sra spots: 4500104 blocks: [[1, 225005], [225006, 450010], [450011, 675015], [675016, 900020], [900021, 1125025], [1125026, 1350030], [1350031, 1575035], [1575036, 1800040], [1800041, 2025045], [2025046, 2250050], [2250051, 2475055], [2475056, 2700060], [2700061, 2925065], [2925066, 3150070], [3150071, 3375075], [3375076, 3600080], [3600081, 3825085], [3825086, 4050090], [4050091, 4275095], [4275096, 4500104]] SRR3207737 file size 944558 SRR3207737 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207737 SRR3207737_1.fastq Input file: SRR3207737_1.fastq trimmed: SRR3207737-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 17:54:46 2025 >> started Mon Feb 10 17:54:48 2025 >> done (2.223s) 4500104 reads processed; of these: 5098 ( 0.11%) short reads filtered out after trimming by size control 4504 ( 0.10%) empty reads filtered out after trimming by size control 4490502 (99.79%) reads available; of these: 493835 (11.00%) trimmed reads available after processing 3996667 (89.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 782 0.02% 19 1460 0.03% 20 2424 0.05% 21 813 0.02% 22 1204 0.03% 23 1864 0.04% 24 3344 0.07% 25 5782 0.13% 26 1420 0.03% 27 1901 0.04% 28 2591 0.06% 29 4041 0.09% 30 6140 0.14% 31 1760 0.04% 32 2320 0.05% 33 2623 0.06% 34 4205 0.09% 35 6628 0.15% 36 1970 0.04% 37 2582 0.06% 38 3750 0.08% 39 6383 0.14% 40 10474 0.23% 41 2544 0.06% 42 3550 0.08% 43 5262 0.12% 44 8850 0.20% 45 14580 0.32% 46 3657 0.08% 47 5101 0.11% 48 7477 0.17% 49 12246 0.27% 50 20794 0.46% 51 5239 0.12% 52 6604 0.15% 53 9906 0.22% 54 16656 0.37% 55 27960 0.62% 56 6697 0.15% 57 9324 0.21% 58 14020 0.31% 59 23867 0.53% 60 42203 0.94% 61 9461 0.21% 62 12728 0.28% 63 19197 0.43% 64 31864 0.71% 65 53641 1.19% 66 13590 0.30% 67 30356 0.68% 68 3996667 89.00% 4490502 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=27 prefix-density=0.05 prefix-fanout=2.2 sequence=GGTGCAAAGATGGTTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=105.55 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=16.1 sequence=CTTCTTCTTCTT Started job on | Feb 10 17:55:00 Started mapping on | Feb 10 17:55:00 Finished on | Feb 10 17:55:06 Mapping speed, Million of reads per hour | 2694.30 Number of input reads | 4490502 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4234619 Uniquely mapped reads % | 94.30% Average mapped length | 66.48 Number of splices: Total | 795172 Number of splices: Annotated (sjdb) | 782713 Number of splices: GT/AG | 783689 Number of splices: GC/AG | 9561 Number of splices: AT/AC | 868 Number of splices: Non-canonical | 1054 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 147061 % of reads mapped to multiple loci | 3.27% Number of reads mapped to too many loci | 76521 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 108822 108822 108822 N_multimapping 147061 147061 147061 N_noFeature 190014 2191098 2203098 N_ambiguous 43558 6425 6738 UnstrandedReadsAssigned:4001047 PositiveStrandReadsAssigned:2037096 NegativeStrandReadsAssigned:2024783 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207737 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207737-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,490,502 reads, 4,145,266 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR3207737.ke.tsv 34699 SRR3207737.se.tsv 87100 total ==> SRR3207737.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 116 21.6723 Potri.005G024800.1.v4.1 1035 936 8 3.06433 Potri.004G059700.1.v4.1 961 862 7 2.91147 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 67.8167 8.54927 Potri.016G087400.1.v4.1 270 171 138 289.337 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 4.28347 Potri.012G127500.1.v4.1 977 878 269 109.845 ==> SRR3207737.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 487 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207737 completed mapping pipeline successfully