Starting /dee2/code/volunteer_pipeline.sh SRR3207738 current disk space = 3057419628544 free memory = 1304464244 SRR3207738 SRAfilesize bc3213238de1d473925dc66343d6acd1 SRR3207738.sra SRR3207738.sra file validated SRR3207738 is single end SRR3207738 is conventional basespace SRR3207738 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207738_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.261 39.0 38.0 40.0 33.0 40.0 2 37.042 39.0 37.0 40.0 33.0 40.0 3 36.962 39.0 37.0 40.0 32.0 40.0 4 37.07275 39.0 37.0 40.0 33.0 40.0 5 36.99075 39.0 37.0 40.0 33.0 40.0 6 37.091 39.0 36.0 40.0 33.0 40.0 7 36.98575 39.0 36.0 40.0 32.0 40.0 8 37.06075 39.0 37.0 40.0 33.0 40.0 9 36.9375 39.0 36.0 40.0 32.0 40.0 10 36.96125 39.0 36.0 40.0 32.0 40.0 11 37.03225 39.0 36.0 40.0 32.0 40.0 12 37.009 39.0 36.0 40.0 32.0 40.0 13 36.97575 38.0 36.0 40.0 32.0 40.0 14 36.9655 38.0 36.0 40.0 32.0 40.0 15 36.7875 38.0 36.0 40.0 31.0 40.0 16 36.824 38.0 36.0 40.0 31.0 40.0 17 36.74575 38.0 36.0 40.0 31.0 40.0 18 36.654 38.0 35.0 40.0 31.0 40.0 19 36.6395 38.0 35.0 40.0 31.0 40.0 20 36.483 38.0 35.0 40.0 31.0 40.0 21 36.4875 38.0 35.0 40.0 31.0 40.0 22 36.417 38.0 35.0 39.0 31.0 40.0 23 36.27075 38.0 35.0 39.0 30.0 40.0 24 36.26175 38.0 35.0 39.0 31.0 40.0 25 36.0435 38.0 35.0 39.0 30.0 40.0 26 35.79775 38.0 35.0 39.0 30.0 40.0 27 35.755 38.0 35.0 39.0 29.0 40.0 28 35.5575 38.0 35.0 39.0 29.0 40.0 29 35.49675 38.0 34.0 39.0 29.0 40.0 30 35.27975 38.0 33.0 39.0 29.0 40.0 31 35.61575 38.0 35.0 39.0 29.0 40.0 32 35.731 38.0 35.0 39.0 30.0 40.0 33 35.49925 38.0 34.0 39.0 29.0 40.0 34 35.5245 38.0 35.0 39.0 29.0 40.0 35 35.43275 38.0 34.0 39.0 29.0 40.0 36 35.4475 38.0 35.0 39.0 29.0 40.0 37 35.41975 38.0 34.0 39.0 29.0 40.0 38 35.233 38.0 34.0 39.0 29.0 40.0 39 35.17075 38.0 34.0 39.0 29.0 40.0 40 35.02075 38.0 34.0 39.0 28.0 40.0 41 34.85175 38.0 33.0 39.0 28.0 40.0 42 34.759 38.0 33.0 39.0 28.0 40.0 43 34.6235 37.0 33.0 39.0 28.0 40.0 44 34.5075 37.0 33.0 39.0 27.0 40.0 45 34.31575 37.0 33.0 39.0 27.0 40.0 46 34.09775 37.0 33.0 39.0 27.0 40.0 47 33.95775 36.0 33.0 39.0 26.0 40.0 48 33.6265 36.0 33.0 39.0 25.0 40.0 49 33.30175 36.0 32.0 39.0 24.0 39.0 50 33.38425 36.0 33.0 39.0 24.0 40.0 51 33.37525 36.0 33.0 39.0 25.0 40.0 52 32.94275 36.0 32.0 39.0 23.0 39.0 53 32.823 36.0 32.0 39.0 23.0 39.0 54 32.58575 36.0 32.0 38.0 23.0 39.0 55 32.27125 35.0 31.0 38.0 22.0 39.0 56 32.038 36.0 31.0 38.0 18.0 39.0 57 31.56775 35.0 31.0 38.0 17.0 39.0 58 31.57275 35.0 31.0 38.0 18.0 39.0 59 31.32225 35.0 31.0 38.0 16.0 39.0 60 30.96975 35.0 30.0 38.0 9.0 39.0 61 30.7855 35.0 30.0 38.0 2.0 39.0 62 30.442 35.0 30.0 38.0 2.0 39.0 63 30.09325 34.0 29.0 37.0 2.0 39.0 64 29.7125 34.0 29.0 37.0 2.0 39.0 65 29.421 33.0 29.0 36.0 2.0 39.0 66 28.8115 33.0 28.0 36.0 2.0 39.0 67 28.643 33.0 28.0 36.0 2.0 39.0 68 27.8575 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 1.0 6 3.0 7 1.0 8 2.0 9 6.0 10 6.0 11 3.0 12 14.0 13 12.0 14 6.0 15 10.0 16 15.0 17 15.0 18 14.0 19 16.0 20 17.0 21 22.0 22 20.0 23 32.0 24 33.0 25 43.0 26 57.0 27 72.0 28 73.0 29 82.0 30 108.0 31 129.0 32 151.0 33 195.0 34 257.0 35 347.0 36 493.0 37 672.0 38 655.0 39 409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.334519572953734 14.133197763091001 17.97153024911032 41.56075241484494 2 18.375 25.924999999999997 36.35 19.35 3 22.875 28.575 25.95 22.6 4 22.95 35.275 20.1 21.675 5 24.175 35.699999999999996 22.325 17.8 6 17.8 37.65 23.375 21.175 7 15.7 16.55 45.175 22.575 8 19.525000000000002 22.6 30.775000000000002 27.1 9 21.099999999999998 22.85 29.849999999999998 26.200000000000003 10 20.225 39.45 22.6 17.724999999999998 11 25.424999999999997 28.349999999999998 21.175 25.05 12 22.05 25.05 27.175 25.724999999999998 13 19.5 28.175 29.875 22.45 14 20.45 27.525 30.025000000000002 22.0 15 21.975 28.375 27.3 22.35 16 21.425 28.549999999999997 26.974999999999998 23.05 17 22.675 28.025 27.450000000000003 21.85 18 22.175 28.599999999999998 27.250000000000004 21.975 19 21.65 28.449999999999996 27.275 22.625 20 20.875 28.175 28.725 22.225 21 20.95 28.299999999999997 28.375 22.375 22 21.275 29.575000000000003 27.075 22.075 23 21.925 28.275 27.800000000000004 22.0 24 21.625 28.749999999999996 28.1 21.525 25 20.95 29.599999999999998 27.425 22.025 26 22.2 28.7 26.775 22.325 27 22.05 28.199999999999996 28.375 21.375 28 22.2 29.45 28.349999999999998 20.0 29 22.35 26.674999999999997 28.249999999999996 22.725 30 21.65 28.65 28.175 21.525 31 21.325 29.275000000000002 26.6 22.8 32 22.725 28.299999999999997 27.6 21.375 33 22.425 28.499999999999996 26.424999999999997 22.650000000000002 34 20.575 28.375 28.199999999999996 22.85 35 21.825 27.750000000000004 28.075 22.35 36 22.7 29.5 26.400000000000002 21.4 37 21.15 29.049999999999997 27.55 22.25 38 21.625 28.000000000000004 28.325 22.05 39 22.5 27.725 28.599999999999998 21.175 40 22.675 27.325 27.975 22.025 41 22.675 27.125 28.075 22.125 42 22.15 27.875 27.200000000000003 22.775000000000002 43 21.325 27.85 29.475 21.349999999999998 44 22.175 27.825 28.1 21.9 45 21.475 28.4 28.549999999999997 21.575 46 21.9 28.1 27.250000000000004 22.75 47 22.025 28.15 26.924999999999997 22.900000000000002 48 21.7 28.849999999999998 27.05 22.400000000000002 49 21.75 28.9 27.925 21.425 50 22.225 28.225 27.575 21.975 51 21.825 27.6 28.125 22.45 52 22.025 27.3 29.375 21.3 53 22.2 28.975 27.250000000000004 21.575 54 23.375 27.450000000000003 27.700000000000003 21.475 55 21.9 28.349999999999998 28.775000000000002 20.974999999999998 56 22.400000000000002 27.650000000000002 27.450000000000003 22.5 57 21.55 28.749999999999996 28.599999999999998 21.099999999999998 58 22.025 28.65 27.825 21.5 59 22.875 27.525 27.6 22.0 60 20.825 28.799999999999997 29.349999999999998 21.025 61 22.0 27.725 27.85 22.425 62 23.375 27.775 27.450000000000003 21.4 63 22.95 26.85 27.900000000000002 22.3 64 21.025 28.349999999999998 28.1 22.525000000000002 65 22.650000000000002 28.025 28.375 20.95 66 22.8 28.825 26.200000000000003 22.175 67 22.7 28.299999999999997 27.725 21.275 68 23.150000000000002 28.799999999999997 26.174999999999997 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.5 22 3.0 23 4.0 24 6.5 25 8.0 26 12.5 27 25.5 28 34.0 29 35.5 30 43.5 31 50.0 32 60.0 33 87.0 34 104.0 35 119.5 36 163.0 37 191.0 38 217.0 39 267.5 40 303.0 41 314.0 42 330.0 43 338.5 44 331.0 45 331.5 46 312.5 47 293.0 48 296.5 49 273.0 50 246.0 51 209.5 52 146.0 53 119.0 54 115.0 55 98.0 56 85.0 57 61.0 58 32.0 59 27.0 60 29.5 61 25.5 62 19.0 63 13.5 64 9.0 65 7.5 66 5.0 67 4.0 68 3.5 69 4.0 70 2.5 71 1.5 72 2.0 73 1.0 74 1.5 75 3.0 76 2.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89982469321312 99.725 2 0.07513148009015778 0.15 3 0.0 0.0 4 0.0 0.0 5 0.025043826696719257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 7 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446550 spots for SRR3207738.sra Written 446550 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra Read 446549 spots for SRR3207738.sra Written 446549 spots for SRR3207738.sra SRR ids: ['SRR3207738.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c5fhtn6y SRR3207738.sra spots: 8930981 blocks: [[1, 446549], [446550, 893098], [893099, 1339647], [1339648, 1786196], [1786197, 2232745], [2232746, 2679294], [2679295, 3125843], [3125844, 3572392], [3572393, 4018941], [4018942, 4465490], [4465491, 4912039], [4912040, 5358588], [5358589, 5805137], [5805138, 6251686], [6251687, 6698235], [6698236, 7144784], [7144785, 7591333], [7591334, 8037882], [8037883, 8484431], [8484432, 8930981]] SRR3207738 file size 1875663 SRR3207738 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207738 SRR3207738_1.fastq Input file: SRR3207738_1.fastq trimmed: SRR3207738-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:39:31 2025 >> started Mon Feb 10 18:39:36 2025 >> done (4.420s) 8930981 reads processed; of these: 10152 ( 0.11%) short reads filtered out after trimming by size control 22984 ( 0.26%) empty reads filtered out after trimming by size control 8897845 (99.63%) reads available; of these: 953087 (10.71%) trimmed reads available after processing 7944758 (89.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1556 0.02% 19 2795 0.03% 20 4802 0.05% 21 1656 0.02% 22 2368 0.03% 23 3732 0.04% 24 6430 0.07% 25 11223 0.13% 26 2812 0.03% 27 3585 0.04% 28 4936 0.06% 29 7733 0.09% 30 11663 0.13% 31 3414 0.04% 32 4530 0.05% 33 5025 0.06% 34 8197 0.09% 35 12902 0.15% 36 3842 0.04% 37 5061 0.06% 38 7408 0.08% 39 12306 0.14% 40 19988 0.22% 41 4891 0.05% 42 6786 0.08% 43 10058 0.11% 44 16867 0.19% 45 28382 0.32% 46 7128 0.08% 47 9617 0.11% 48 14321 0.16% 49 23472 0.26% 50 40064 0.45% 51 9827 0.11% 52 12748 0.14% 53 19227 0.22% 54 31960 0.36% 55 54537 0.61% 56 12697 0.14% 57 17620 0.20% 58 26531 0.30% 59 46344 0.52% 60 81162 0.91% 61 17794 0.20% 62 24490 0.28% 63 36864 0.41% 64 61847 0.70% 65 104910 1.18% 66 26061 0.29% 67 58918 0.66% 68 7944758 89.29% 8897845 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=7.20 fanout-score-rank=16 prefix-density=0.08 prefix-fanout=3.7 sequence=GCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=215.47 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=22.5 sequence=TTCTTCTTCTTC Started job on | Feb 10 18:39:50 Started mapping on | Feb 10 18:39:51 Finished on | Feb 10 18:40:17 Mapping speed, Million of reads per hour | 1232.01 Number of input reads | 8897845 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8439090 Uniquely mapped reads % | 94.84% Average mapped length | 66.50 Number of splices: Total | 1608960 Number of splices: Annotated (sjdb) | 1583853 Number of splices: GT/AG | 1585643 Number of splices: GC/AG | 19575 Number of splices: AT/AC | 1672 Number of splices: Non-canonical | 2070 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286869 % of reads mapped to multiple loci | 3.22% Number of reads mapped to too many loci | 130155 % of reads mapped to too many loci | 1.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171886 171886 171886 N_multimapping 286869 286869 286869 N_noFeature 362841 4357278 4387948 N_ambiguous 81449 12255 12585 UnstrandedReadsAssigned:7994800 PositiveStrandReadsAssigned:4069557 NegativeStrandReadsAssigned:4038557 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207738 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207738-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,897,845 reads, 8,256,241 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR3207738.ke.tsv 34699 SRR3207738.se.tsv 87100 total ==> SRR3207738.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 207 19.407 Potri.005G024800.1.v4.1 1035 936 23 4.42095 Potri.004G059700.1.v4.1 961 862 8 1.66973 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 127.698 8.07824 Potri.016G087400.1.v4.1 270 171 285 299.856 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 26 2.79436 Potri.012G127500.1.v4.1 977 878 812 166.389 ==> SRR3207738.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 701 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 138 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207738 completed mapping pipeline successfully