Starting /dee2/code/volunteer_pipeline.sh SRR3207739 current disk space = 3057116782592 free memory = 1578586416 SRR3207739 SRAfilesize e9da2b27b7e72e280eadc278bb47ce24 SRR3207739.sra SRR3207739.sra file validated SRR3207739 is single end SRR3207739 is conventional basespace SRR3207739 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207739_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.11875 39.0 38.0 40.0 33.0 40.0 2 36.90525 39.0 37.0 40.0 33.0 40.0 3 36.91375 39.0 37.0 40.0 33.0 40.0 4 36.859 39.0 37.0 40.0 33.0 40.0 5 36.871 39.0 36.0 40.0 33.0 40.0 6 36.92625 39.0 36.0 40.0 33.0 40.0 7 36.944 39.0 37.0 40.0 33.0 40.0 8 36.795 39.0 36.0 40.0 31.0 40.0 9 36.73975 39.0 36.0 40.0 31.0 40.0 10 36.78925 39.0 36.0 40.0 32.0 40.0 11 36.90775 39.0 36.0 40.0 32.0 40.0 12 36.78575 39.0 36.0 40.0 31.0 40.0 13 36.847 39.0 36.0 40.0 31.0 40.0 14 36.824 38.0 36.0 40.0 32.0 40.0 15 36.699 38.0 35.0 40.0 31.0 40.0 16 36.6375 38.0 36.0 40.0 31.0 40.0 17 36.69875 38.0 36.0 40.0 31.0 40.0 18 36.5125 38.0 35.0 40.0 31.0 40.0 19 36.54575 38.0 35.0 40.0 31.0 40.0 20 36.3945 38.0 35.0 40.0 31.0 40.0 21 36.44 38.0 35.0 40.0 31.0 40.0 22 36.35475 38.0 35.0 40.0 31.0 40.0 23 36.24725 38.0 35.0 39.0 31.0 40.0 24 36.092 38.0 35.0 39.0 30.0 40.0 25 35.9245 38.0 35.0 39.0 30.0 40.0 26 35.68975 38.0 35.0 39.0 30.0 40.0 27 35.5995 38.0 35.0 39.0 29.0 40.0 28 35.30375 38.0 34.0 39.0 29.0 40.0 29 35.39425 38.0 34.0 39.0 29.0 40.0 30 35.16175 38.0 34.0 39.0 28.0 40.0 31 35.46625 38.0 35.0 39.0 29.0 40.0 32 35.41175 38.0 35.0 39.0 29.0 40.0 33 35.34375 38.0 34.0 39.0 29.0 40.0 34 35.26325 38.0 34.0 39.0 29.0 40.0 35 35.1765 38.0 35.0 39.0 29.0 40.0 36 35.255 38.0 35.0 39.0 29.0 40.0 37 35.14075 38.0 34.0 39.0 29.0 40.0 38 35.026 38.0 34.0 39.0 29.0 40.0 39 34.82725 38.0 34.0 39.0 27.0 40.0 40 34.79275 38.0 34.0 39.0 27.0 40.0 41 34.77275 38.0 34.0 39.0 28.0 40.0 42 34.62225 38.0 33.0 39.0 28.0 40.0 43 34.4005 37.0 33.0 39.0 27.0 40.0 44 34.2635 37.0 33.0 39.0 27.0 40.0 45 34.2215 37.0 33.0 39.0 27.0 40.0 46 33.77425 37.0 33.0 39.0 25.0 40.0 47 33.639 36.0 33.0 39.0 25.0 40.0 48 33.4155 36.0 33.0 39.0 24.0 40.0 49 32.925 36.0 32.0 39.0 23.0 40.0 50 33.14875 36.0 33.0 39.0 23.0 40.0 51 32.90025 36.0 32.0 39.0 23.0 40.0 52 32.67675 36.0 32.0 39.0 22.0 39.0 53 32.46075 36.0 32.0 39.0 22.0 39.0 54 32.2565 36.0 31.0 38.0 21.0 39.0 55 32.034 36.0 31.0 38.0 18.0 39.0 56 31.92575 36.0 31.0 38.0 17.0 39.0 57 31.52975 35.0 31.0 38.0 15.0 39.0 58 31.38875 35.0 31.0 38.0 15.0 39.0 59 31.1305 35.0 31.0 38.0 11.0 39.0 60 30.798 35.0 30.0 38.0 2.0 39.0 61 30.74625 35.0 31.0 38.0 2.0 39.0 62 30.2035 35.0 30.0 38.0 2.0 39.0 63 30.08275 34.0 29.0 38.0 2.0 39.0 64 29.73325 34.0 29.0 37.0 2.0 39.0 65 29.161 33.0 29.0 36.0 2.0 39.0 66 28.70575 33.0 28.0 36.0 2.0 39.0 67 28.482 33.0 27.0 36.0 2.0 39.0 68 27.81 33.0 26.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 1.0 4 0.0 5 3.0 6 4.0 7 1.0 8 5.0 9 2.0 10 4.0 11 9.0 12 12.0 13 16.0 14 13.0 15 8.0 16 14.0 17 18.0 18 11.0 19 21.0 20 26.0 21 29.0 22 38.0 23 28.0 24 30.0 25 38.0 26 59.0 27 57.0 28 73.0 29 75.0 30 92.0 31 113.0 32 155.0 33 187.0 34 266.0 35 355.0 36 502.0 37 642.0 38 641.0 39 435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.685393258426966 13.840653728294178 18.74361593462717 40.73033707865169 2 19.35 24.6 35.8 20.25 3 22.25 29.549999999999997 25.650000000000002 22.55 4 24.025 34.325 19.575 22.075 5 24.525 34.8 21.425 19.25 6 17.0 37.275000000000006 24.625 21.099999999999998 7 16.225 17.424999999999997 44.65 21.7 8 19.8 24.099999999999998 28.4 27.700000000000003 9 20.7 23.1 30.825000000000003 25.374999999999996 10 20.8 37.574999999999996 24.125 17.5 11 25.95 28.000000000000004 20.200000000000003 25.85 12 21.175 24.375 29.2 25.25 13 19.175 26.950000000000003 32.45 21.425 14 20.4 27.725 30.15 21.725 15 21.15 27.35 28.275 23.225 16 20.65 28.775000000000002 27.725 22.85 17 22.7 28.125 27.275 21.9 18 20.974999999999998 28.425 28.449999999999996 22.15 19 20.5 29.299999999999997 28.175 22.025 20 21.3 28.225 28.225 22.25 21 21.125 26.825 28.999999999999996 23.05 22 20.849999999999998 28.875 28.075 22.2 23 20.45 29.4 27.625 22.525000000000002 24 22.25 27.200000000000003 27.85 22.7 25 21.349999999999998 28.95 27.775 21.925 26 22.275 29.275000000000002 26.1 22.35 27 21.275 29.45 28.000000000000004 21.275 28 21.125 29.2 26.924999999999997 22.75 29 21.025 28.975 27.750000000000004 22.25 30 20.849999999999998 28.675 27.075 23.400000000000002 31 21.175 27.725 27.400000000000002 23.7 32 21.875 29.175 25.874999999999996 23.075000000000003 33 22.25 27.450000000000003 28.249999999999996 22.05 34 22.375 27.0 29.175 21.45 35 21.7 28.425 27.800000000000004 22.075 36 22.1 29.349999999999998 27.6 20.95 37 21.425 28.299999999999997 28.025 22.25 38 21.625 28.075 28.225 22.075 39 22.725 27.675 27.425 22.175 40 21.575 28.275 28.225 21.925 41 21.4 28.725 28.525 21.349999999999998 42 22.25 27.725 27.500000000000004 22.525000000000002 43 20.925 28.025 28.349999999999998 22.7 44 22.0 29.375 27.450000000000003 21.175 45 22.0 28.000000000000004 28.125 21.875 46 22.025 27.175 27.925 22.875 47 21.95 28.549999999999997 27.450000000000003 22.05 48 22.025 27.950000000000003 26.775 23.25 49 21.4 29.5 27.525 21.575 50 22.575 28.425 27.450000000000003 21.55 51 21.775 29.125 26.900000000000002 22.2 52 21.625 27.474999999999998 28.449999999999996 22.45 53 21.975 27.35 27.85 22.825 54 22.075 28.249999999999996 27.875 21.8 55 21.15 28.65 27.500000000000004 22.7 56 21.925 28.175 28.199999999999996 21.7 57 22.75 27.150000000000002 27.950000000000003 22.15 58 22.125 28.499999999999996 27.025 22.35 59 22.05 28.449999999999996 28.325 21.175 60 23.0 27.450000000000003 26.85 22.7 61 23.5 27.400000000000002 27.1 22.0 62 22.55 27.900000000000002 27.85 21.7 63 22.375 27.6 27.900000000000002 22.125 64 22.575 27.6 28.775000000000002 21.05 65 23.175 28.249999999999996 27.800000000000004 20.775 66 23.150000000000002 27.3 27.800000000000004 21.75 67 22.2 28.9 27.05 21.85 68 23.9 27.0 26.724999999999998 22.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 1.0 19 2.0 20 3.0 21 3.0 22 2.0 23 2.5 24 7.5 25 12.0 26 11.0 27 14.5 28 19.0 29 24.5 30 40.0 31 50.0 32 68.5 33 91.0 34 95.0 35 120.0 36 156.5 37 168.0 38 214.5 39 258.5 40 302.0 41 348.0 42 348.0 43 349.0 44 350.0 45 350.0 46 338.5 47 327.0 48 297.5 49 248.5 50 229.0 51 200.5 52 151.5 53 131.0 54 105.0 55 74.5 56 70.0 57 59.0 58 38.5 59 29.0 60 28.5 61 21.5 62 15.0 63 13.0 64 10.5 65 11.0 66 12.0 67 9.5 68 6.0 69 5.0 70 4.0 71 3.0 72 3.0 73 3.0 74 3.0 75 3.0 76 1.5 77 1.0 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429989 spots for SRR3207739.sra Written 429989 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra Read 429980 spots for SRR3207739.sra Written 429980 spots for SRR3207739.sra SRR ids: ['SRR3207739.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iljuwt7k SRR3207739.sra spots: 8599609 blocks: [[1, 429980], [429981, 859960], [859961, 1289940], [1289941, 1719920], [1719921, 2149900], [2149901, 2579880], [2579881, 3009860], [3009861, 3439840], [3439841, 3869820], [3869821, 4299800], [4299801, 4729780], [4729781, 5159760], [5159761, 5589740], [5589741, 6019720], [6019721, 6449700], [6449701, 6879680], [6879681, 7309660], [7309661, 7739640], [7739641, 8169620], [8169621, 8599609]] SRR3207739 file size 1806028 SRR3207739 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207739 SRR3207739_1.fastq Input file: SRR3207739_1.fastq trimmed: SRR3207739-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:02:46 2025 >> started Mon Feb 10 19:02:50 2025 >> done (3.941s) 8599609 reads processed; of these: 9810 ( 0.11%) short reads filtered out after trimming by size control 11581 ( 0.13%) empty reads filtered out after trimming by size control 8578218 (99.75%) reads available; of these: 934335 (10.89%) trimmed reads available after processing 7643883 (89.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1561 0.02% 19 2742 0.03% 20 4780 0.06% 21 1609 0.02% 22 2387 0.03% 23 3807 0.04% 24 6528 0.08% 25 11387 0.13% 26 2770 0.03% 27 3579 0.04% 28 5015 0.06% 29 7724 0.09% 30 11930 0.14% 31 3472 0.04% 32 4531 0.05% 33 4951 0.06% 34 8062 0.09% 35 12976 0.15% 36 3823 0.04% 37 5022 0.06% 38 7537 0.09% 39 12364 0.14% 40 20206 0.24% 41 4911 0.06% 42 6818 0.08% 43 10219 0.12% 44 16833 0.20% 45 28313 0.33% 46 7025 0.08% 47 9552 0.11% 48 14347 0.17% 49 23040 0.27% 50 39622 0.46% 51 9927 0.12% 52 12562 0.15% 53 18801 0.22% 54 31279 0.36% 55 53426 0.62% 56 12419 0.14% 57 17328 0.20% 58 26194 0.31% 59 44895 0.52% 60 78503 0.92% 61 17329 0.20% 62 24084 0.28% 63 35865 0.42% 64 59225 0.69% 65 101322 1.18% 66 24918 0.29% 67 56815 0.66% 68 7643883 89.11% 8578218 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=32 prefix-density=0.04 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=139.51 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=18.7 sequence=TTCTTCTTCTTT Started job on | Feb 10 19:03:03 Started mapping on | Feb 10 19:03:03 Finished on | Feb 10 19:03:12 Mapping speed, Million of reads per hour | 3431.29 Number of input reads | 8578218 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8025540 Uniquely mapped reads % | 93.56% Average mapped length | 66.52 Number of splices: Total | 1490043 Number of splices: Annotated (sjdb) | 1465419 Number of splices: GT/AG | 1468282 Number of splices: GC/AG | 18122 Number of splices: AT/AC | 1620 Number of splices: Non-canonical | 2019 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282689 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 230633 % of reads mapped to too many loci | 2.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 269989 269989 269989 N_multimapping 282689 282689 282689 N_noFeature 379410 4167082 4181438 N_ambiguous 81451 12285 12855 UnstrandedReadsAssigned:7564679 PositiveStrandReadsAssigned:3846173 NegativeStrandReadsAssigned:3831247 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207739 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207739-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,578,218 reads, 7,911,532 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR3207739.ke.tsv 34699 SRR3207739.se.tsv 87100 total ==> SRR3207739.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 185 18.3164 Potri.005G024800.1.v4.1 1035 936 29 5.88663 Potri.004G059700.1.v4.1 961 862 3 0.661239 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 144.648 9.66337 Potri.016G087400.1.v4.1 270 171 286 317.771 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 30 3.40495 Potri.012G127500.1.v4.1 977 878 676 146.284 ==> SRR3207739.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 870 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 151 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR3207739 completed mapping pipeline successfully