Starting /dee2/code/volunteer_pipeline.sh SRR3207740 current disk space = 3057665265664 free memory = 1206109968 SRR3207740 SRAfilesize 443dd573d91ba56ccb113d67b5f52478 SRR3207740.sra SRR3207740.sra file validated SRR3207740 is single end SRR3207740 is conventional basespace SRR3207740 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207740_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.066 38.0 36.0 39.0 33.0 40.0 2 36.7275 38.0 36.0 39.0 31.0 40.0 3 36.6645 38.0 36.0 39.0 31.0 40.0 4 36.6335 38.0 36.0 39.0 31.0 40.0 5 36.70525 38.0 36.0 39.0 31.0 40.0 6 36.68825 38.0 36.0 39.0 31.0 40.0 7 36.62375 38.0 35.0 39.0 31.0 40.0 8 36.6585 38.0 36.0 39.0 31.0 40.0 9 36.55775 38.0 35.0 39.0 31.0 40.0 10 36.52925 38.0 35.0 39.0 31.0 40.0 11 36.567 38.0 35.0 39.0 31.0 40.0 12 36.36125 38.0 35.0 39.0 31.0 40.0 13 36.437 38.0 35.0 39.0 31.0 40.0 14 36.40925 38.0 35.0 39.0 31.0 40.0 15 36.34275 38.0 35.0 39.0 31.0 40.0 16 36.33075 38.0 35.0 39.0 31.0 40.0 17 35.997 38.0 35.0 39.0 30.0 40.0 18 36.01775 38.0 35.0 39.0 30.0 40.0 19 35.76875 38.0 35.0 39.0 29.0 40.0 20 35.73825 38.0 35.0 39.0 29.0 40.0 21 35.5775 38.0 35.0 39.0 29.0 40.0 22 35.507 38.0 35.0 39.0 29.0 40.0 23 35.31925 38.0 33.0 39.0 28.0 40.0 24 35.2235 38.0 33.0 39.0 28.0 40.0 25 35.07825 38.0 33.0 39.0 28.0 40.0 26 34.59425 38.0 33.0 39.0 27.0 40.0 27 34.547 38.0 33.0 39.0 27.0 40.0 28 34.42325 37.0 33.0 39.0 26.0 40.0 29 34.22675 37.0 33.0 39.0 26.0 40.0 30 34.08 37.0 33.0 39.0 26.0 40.0 31 34.11775 38.0 33.0 39.0 25.0 40.0 32 34.03 37.0 33.0 39.0 26.0 40.0 33 34.019 37.0 33.0 39.0 25.0 40.0 34 33.71225 37.0 33.0 39.0 24.0 40.0 35 33.746 37.0 33.0 39.0 25.0 40.0 36 33.97275 38.0 33.0 39.0 25.0 40.0 37 33.72425 37.0 33.0 39.0 23.0 40.0 38 33.6305 37.0 33.0 39.0 23.0 40.0 39 33.42625 37.0 33.0 39.0 23.0 40.0 40 33.373 37.0 32.0 39.0 23.0 40.0 41 33.3065 37.0 33.0 39.0 23.0 40.0 42 32.9715 36.0 32.0 39.0 23.0 40.0 43 32.7105 36.0 32.0 39.0 22.0 40.0 44 32.57975 36.0 32.0 39.0 20.0 40.0 45 32.47275 36.0 31.0 39.0 20.0 40.0 46 32.26625 36.0 31.0 39.0 18.0 40.0 47 31.76525 36.0 31.0 39.0 15.0 40.0 48 31.649 36.0 31.0 39.0 14.0 40.0 49 31.44625 35.0 30.0 39.0 11.0 40.0 50 31.1165 35.0 30.0 38.0 2.0 40.0 51 30.86425 35.0 30.0 38.0 2.0 39.0 52 30.41975 35.0 29.0 38.0 2.0 39.0 53 30.102 35.0 29.0 38.0 2.0 39.0 54 30.02625 35.0 29.0 38.0 2.0 39.0 55 29.71775 35.0 29.0 38.0 2.0 39.0 56 29.37075 35.0 28.0 38.0 2.0 39.0 57 28.731 34.0 27.0 38.0 2.0 39.0 58 28.517 33.0 27.0 37.0 2.0 39.0 59 28.40575 33.0 27.0 37.0 2.0 39.0 60 28.129 33.0 26.0 37.0 2.0 39.0 61 27.71325 33.0 24.0 37.0 2.0 39.0 62 27.5775 33.0 24.0 37.0 2.0 39.0 63 27.50625 33.0 24.0 37.0 2.0 39.0 64 26.81675 33.0 23.0 36.0 2.0 39.0 65 26.447 33.0 22.0 36.0 2.0 39.0 66 26.14075 33.0 18.0 36.0 2.0 39.0 67 25.77475 33.0 17.0 36.0 2.0 39.0 68 25.20975 32.0 15.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 1.0 6 3.0 7 4.0 8 10.0 9 8.0 10 15.0 11 15.0 12 14.0 13 22.0 14 26.0 15 22.0 16 24.0 17 35.0 18 27.0 19 24.0 20 45.0 21 43.0 22 55.0 23 49.0 24 69.0 25 63.0 26 80.0 27 62.0 28 96.0 29 99.0 30 113.0 31 132.0 32 188.0 33 208.0 34 278.0 35 382.0 36 411.0 37 528.0 38 500.0 39 341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.71629778672032 12.147887323943662 17.630784708249497 42.50503018108652 2 21.975 21.975 32.300000000000004 23.75 3 26.375 25.2 23.125 25.3 4 28.849999999999998 30.025000000000002 17.775 23.35 5 27.55 32.85 20.775 18.825 6 22.025 34.949999999999996 23.599999999999998 19.425 7 18.125 17.675 42.199999999999996 22.0 8 20.200000000000003 22.3 27.474999999999998 30.025000000000002 9 20.875 23.025000000000002 29.25 26.85 10 21.525 37.7 21.425 19.35 11 26.6 26.700000000000003 19.725 26.974999999999998 12 22.75 23.225 28.050000000000004 25.974999999999998 13 21.15 26.325 30.599999999999998 21.925 14 23.474999999999998 25.624999999999996 27.3 23.599999999999998 15 23.7 26.275 27.250000000000004 22.775000000000002 16 24.075 25.874999999999996 26.275 23.775 17 24.525 25.324999999999996 26.924999999999997 23.225 18 22.6 28.175 25.374999999999996 23.849999999999998 19 23.525 26.200000000000003 26.150000000000002 24.125 20 22.425 26.125 28.000000000000004 23.45 21 22.925 26.875 26.650000000000002 23.549999999999997 22 23.0 25.674999999999997 26.3 25.025 23 24.025 26.525 26.75 22.7 24 25.0 26.400000000000002 25.05 23.549999999999997 25 22.925 25.75 25.900000000000002 25.424999999999997 26 24.8 26.025 25.55 23.625 27 24.575 26.474999999999998 25.324999999999996 23.625 28 24.2 26.025 26.1 23.674999999999997 29 23.200000000000003 27.975 24.775 24.05 30 23.825 27.250000000000004 25.124999999999996 23.799999999999997 31 21.65 27.525 27.775 23.05 32 25.275 26.275 25.624999999999996 22.825 33 21.75 26.400000000000002 27.450000000000003 24.4 34 23.425 25.825 25.75 25.0 35 22.6 27.425 25.474999999999998 24.5 36 22.3 27.425 26.674999999999997 23.599999999999998 37 22.1 27.3 27.450000000000003 23.150000000000002 38 23.200000000000003 26.375 26.325 24.099999999999998 39 23.9 27.125 24.45 24.525 40 23.525 27.800000000000004 24.725 23.95 41 24.875 26.3 26.424999999999997 22.400000000000002 42 24.575 26.025 26.625 22.775000000000002 43 22.95 27.075 26.825 23.150000000000002 44 22.8 26.924999999999997 27.250000000000004 23.025000000000002 45 23.625 25.825 26.0 24.55 46 24.099999999999998 25.874999999999996 27.0 23.025000000000002 47 22.175 27.575 27.474999999999998 22.775000000000002 48 22.875 28.15 24.75 24.224999999999998 49 23.674999999999997 28.075 25.650000000000002 22.6 50 23.45 26.200000000000003 25.6 24.75 51 22.125 27.725 25.874999999999996 24.275 52 23.925 28.65 25.5 21.925 53 22.8 27.575 26.125 23.5 54 23.549999999999997 27.150000000000002 25.3 24.0 55 24.6 26.275 25.35 23.775 56 24.275 25.974999999999998 26.025 23.724999999999998 57 23.525 27.6 25.45 23.425 58 24.25 27.025 25.374999999999996 23.35 59 23.95 26.474999999999998 26.075 23.5 60 25.775 25.25 25.6 23.375 61 23.025000000000002 26.974999999999998 26.174999999999997 23.825 62 23.150000000000002 27.975 24.625 24.25 63 22.900000000000002 27.675 26.5 22.925 64 24.4 25.324999999999996 26.75 23.525 65 23.0 27.325 25.374999999999996 24.3 66 24.2 26.375 26.674999999999997 22.75 67 23.075000000000003 27.150000000000002 26.0 23.775 68 24.099999999999998 26.0 26.3 23.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 5.5 25 9.0 26 12.5 27 17.5 28 19.0 29 19.0 30 28.0 31 37.0 32 45.0 33 57.5 34 62.0 35 76.0 36 114.0 37 138.0 38 159.0 39 184.5 40 216.5 41 244.0 42 245.0 43 256.5 44 267.0 45 289.5 46 317.5 47 323.0 48 299.5 49 286.5 50 297.0 51 263.5 52 198.0 53 166.0 54 158.0 55 140.5 56 131.0 57 117.0 58 96.5 59 90.0 60 82.0 61 62.0 62 50.0 63 44.5 64 32.0 65 20.5 66 16.0 67 19.5 68 23.5 69 24.0 70 21.5 71 16.5 72 14.0 73 14.5 74 15.0 75 15.0 76 12.5 77 9.0 78 8.0 79 8.0 80 5.0 81 2.0 82 3.0 83 2.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.6186935740839 90.025 2 3.186404673393521 6.0 3 0.8497079129049389 2.4 4 0.18587360594795538 0.7000000000000001 5 0.07966011683483802 0.375 6 0.05310674455655868 0.3 7 0.0 0.0 8 0.02655337227827934 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 8 0.2 No Hit CTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTG 6 0.15 No Hit CAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTATGGGTGGTGGTGCATG 6 0.15 No Hit CAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGAATTCCTCGTTGAAGACC 5 0.125 No Hit ACTAGTATGGCCCGGGGGATCCTACGTTCCAAATGCAGCGAGCTCGTATAACCCTTTAAGAGTTGCTC 5 0.125 No Hit GCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCCGACTTTGTGAAATGACTTGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra Read 197815 spots for SRR3207740.sra Written 197815 spots for SRR3207740.sra SRR ids: ['SRR3207740.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g_jsv0du SRR3207740.sra spots: 3956300 blocks: [[1, 197815], [197816, 395630], [395631, 593445], [593446, 791260], [791261, 989075], [989076, 1186890], [1186891, 1384705], [1384706, 1582520], [1582521, 1780335], [1780336, 1978150], [1978151, 2175965], [2175966, 2373780], [2373781, 2571595], [2571596, 2769410], [2769411, 2967225], [2967226, 3165040], [3165041, 3362855], [3362856, 3560670], [3560671, 3758485], [3758486, 3956300]] SRR3207740 file size 830292 SRR3207740 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207740 SRR3207740_1.fastq Input file: SRR3207740_1.fastq trimmed: SRR3207740-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:13:52 2025 >> started Mon Feb 10 18:13:59 2025 >> done (7.571s) 3956300 reads processed; of these: 11164 ( 0.28%) short reads filtered out after trimming by size control 13513 ( 0.34%) empty reads filtered out after trimming by size control 3931623 (99.38%) reads available; of these: 906518 (23.06%) trimmed reads available after processing 3025105 (76.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2273 0.06% 19 3884 0.10% 20 6965 0.18% 21 2272 0.06% 22 3456 0.09% 23 5464 0.14% 24 9891 0.25% 25 16277 0.41% 26 3704 0.09% 27 4882 0.12% 28 6774 0.17% 29 11143 0.28% 30 16234 0.41% 31 4581 0.12% 32 6670 0.17% 33 6676 0.17% 34 10850 0.28% 35 16941 0.43% 36 5081 0.13% 37 6401 0.16% 38 10291 0.26% 39 16660 0.42% 40 25990 0.66% 41 6814 0.17% 42 9161 0.23% 43 12818 0.33% 44 20235 0.51% 45 32992 0.84% 46 8439 0.21% 47 11298 0.29% 48 16276 0.41% 49 25918 0.66% 50 40568 1.03% 51 10786 0.27% 52 13498 0.34% 53 19332 0.49% 54 32125 0.82% 55 49464 1.26% 56 12878 0.33% 57 16343 0.42% 58 23925 0.61% 59 39044 0.99% 60 66100 1.68% 61 15736 0.40% 62 21127 0.54% 63 29176 0.74% 64 46186 1.17% 65 71467 1.82% 66 17640 0.45% 67 33812 0.86% 68 3025105 76.94% 3931623 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=16.47 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=1.7 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC Started job on | Feb 10 18:14:23 Started mapping on | Feb 10 18:14:28 Finished on | Feb 10 18:14:49 Mapping speed, Million of reads per hour | 673.99 Number of input reads | 3931623 Average input read length | 64 UNIQUE READS: Uniquely mapped reads number | 2210273 Uniquely mapped reads % | 56.22% Average mapped length | 66.08 Number of splices: Total | 388222 Number of splices: Annotated (sjdb) | 381702 Number of splices: GT/AG | 382400 Number of splices: GC/AG | 4847 Number of splices: AT/AC | 410 Number of splices: Non-canonical | 565 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101247 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 1563791 % of reads mapped to too many loci | 39.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1620103 1620103 1620103 N_multimapping 101247 101247 101247 N_noFeature 147256 1160557 1179662 N_ambiguous 24036 3344 3417 UnstrandedReadsAssigned:2038981 PositiveStrandReadsAssigned:1046372 NegativeStrandReadsAssigned:1027194 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=65 echo kmer=61 SRR3207740 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207740-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,931,623 reads, 3,363,696 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 956 rounds 52401 SRR3207740.ke.tsv 34699 SRR3207740.se.tsv 87100 total ==> SRR3207740.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 56 10.7413 Potri.005G024800.1.v4.1 1035 936 13 5.11224 Potri.004G059700.1.v4.1 961 862 2 0.854017 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30.4165 3.93662 Potri.016G087400.1.v4.1 270 171 71 152.829 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 13 2.85846 Potri.012G127500.1.v4.1 977 878 198 83.0069 ==> SRR3207740.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 243 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 61 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207740 completed mapping pipeline successfully