Starting /dee2/code/volunteer_pipeline.sh SRR3207741 current disk space = 3057588580352 free memory = 1169442724 SRR3207741 SRAfilesize 8533e9e1b80a08887141008aa5072cde SRR3207741.sra SRR3207741.sra file validated SRR3207741 is single end SRR3207741 is conventional basespace SRR3207741 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207741_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.8155 38.0 36.0 39.0 33.0 40.0 2 36.46225 38.0 36.0 39.0 31.0 40.0 3 36.44425 38.0 36.0 39.0 30.0 40.0 4 36.46425 38.0 35.0 39.0 31.0 40.0 5 36.47 38.0 36.0 39.0 31.0 40.0 6 36.509 38.0 36.0 39.0 31.0 40.0 7 36.50225 38.0 36.0 39.0 31.0 40.0 8 36.3445 38.0 35.0 39.0 31.0 40.0 9 36.35875 38.0 35.0 39.0 30.0 40.0 10 36.325 38.0 35.0 39.0 30.0 40.0 11 36.47525 38.0 35.0 39.0 31.0 40.0 12 36.476 38.0 35.0 39.0 31.0 40.0 13 36.415 38.0 35.0 39.0 31.0 40.0 14 36.32275 38.0 35.0 39.0 31.0 40.0 15 36.323 38.0 35.0 39.0 31.0 40.0 16 36.41025 38.0 35.0 39.0 31.0 40.0 17 36.12425 38.0 35.0 39.0 30.0 40.0 18 36.041 38.0 35.0 39.0 29.0 40.0 19 36.0415 38.0 35.0 39.0 30.0 40.0 20 35.793 38.0 35.0 39.0 29.0 40.0 21 35.78825 38.0 35.0 39.0 29.0 40.0 22 35.64775 38.0 35.0 39.0 29.0 40.0 23 35.61375 38.0 35.0 39.0 29.0 40.0 24 35.5895 38.0 34.0 39.0 29.0 40.0 25 35.494 38.0 35.0 39.0 29.0 40.0 26 35.1775 38.0 34.0 39.0 28.0 40.0 27 35.154 38.0 34.0 39.0 28.0 40.0 28 35.102 38.0 33.0 39.0 28.0 40.0 29 34.85825 38.0 33.0 39.0 27.0 40.0 30 34.70825 38.0 33.0 39.0 27.0 40.0 31 35.0075 38.0 34.0 39.0 28.0 40.0 32 34.88375 38.0 33.0 39.0 27.0 40.0 33 34.832 38.0 33.0 39.0 27.0 40.0 34 34.60775 38.0 33.0 39.0 27.0 40.0 35 34.59475 38.0 33.0 39.0 27.0 40.0 36 34.93275 38.0 34.0 39.0 28.0 40.0 37 34.68325 38.0 33.0 39.0 27.0 40.0 38 34.49075 38.0 33.0 39.0 27.0 40.0 39 34.42025 37.0 33.0 39.0 27.0 40.0 40 34.50525 37.0 33.0 39.0 27.0 40.0 41 34.3975 38.0 33.0 39.0 27.0 40.0 42 34.06225 37.0 33.0 39.0 26.0 40.0 43 33.995 37.0 33.0 39.0 26.0 40.0 44 33.87875 36.0 33.0 39.0 25.0 40.0 45 33.73475 36.0 33.0 39.0 26.0 40.0 46 33.61925 37.0 33.0 39.0 24.0 40.0 47 33.4025 36.0 33.0 39.0 24.0 40.0 48 33.11875 36.0 32.0 39.0 23.0 40.0 49 33.02975 36.0 32.0 39.0 23.0 40.0 50 32.6675 36.0 32.0 39.0 22.0 40.0 51 32.33575 36.0 31.0 39.0 19.0 39.0 52 31.93225 35.0 31.0 38.0 18.0 39.0 53 31.63875 35.0 31.0 38.0 17.0 39.0 54 31.53875 35.0 30.0 38.0 17.0 39.0 55 31.5165 35.0 30.0 38.0 17.0 39.0 56 31.03725 35.0 30.0 38.0 10.0 39.0 57 30.63575 35.0 29.0 38.0 8.0 39.0 58 30.37625 35.0 29.0 38.0 2.0 39.0 59 30.223 34.0 29.0 38.0 2.0 39.0 60 29.794 34.0 29.0 37.0 2.0 39.0 61 29.6275 34.0 29.0 37.0 2.0 39.0 62 29.45925 34.0 29.0 37.0 2.0 39.0 63 29.44275 34.0 29.0 38.0 2.0 39.0 64 28.79825 33.0 28.0 37.0 2.0 39.0 65 28.42 33.0 27.0 36.0 2.0 39.0 66 28.02575 33.0 27.0 36.0 2.0 39.0 67 27.83875 33.0 27.0 36.0 2.0 39.0 68 27.167 33.0 23.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 1.0 5 1.0 6 3.0 7 5.0 8 3.0 9 4.0 10 8.0 11 9.0 12 13.0 13 9.0 14 12.0 15 15.0 16 17.0 17 22.0 18 16.0 19 22.0 20 23.0 21 43.0 22 28.0 23 30.0 24 44.0 25 56.0 26 76.0 27 75.0 28 78.0 29 125.0 30 96.0 31 150.0 32 152.0 33 201.0 34 288.0 35 380.0 36 486.0 37 561.0 38 608.0 39 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.499112351001777 14.02485417195029 16.256657367486685 45.219376109561246 2 18.3 27.250000000000004 34.5 19.950000000000003 3 24.275 30.049999999999997 23.525 22.15 4 25.275 34.35 19.1 21.275 5 24.099999999999998 35.949999999999996 22.375 17.575 6 17.65 37.974999999999994 24.675 19.7 7 16.575 16.35 45.375 21.7 8 20.275000000000002 22.825 28.4 28.499999999999996 9 20.605151287821954 22.73068267066767 31.23280820205051 25.431357839459867 10 19.675 39.975 21.975 18.375 11 24.9 28.825 20.875 25.4 12 21.475 24.5 28.999999999999996 25.025 13 19.3 29.175 31.0 20.525 14 20.9 27.575 28.9 22.625 15 20.9 27.400000000000002 28.249999999999996 23.45 16 21.725 28.799999999999997 26.974999999999998 22.5 17 22.475 29.225 26.05 22.25 18 20.8 28.299999999999997 28.95 21.95 19 21.45 28.15 27.125 23.275000000000002 20 20.825 28.375 26.875 23.925 21 21.325 29.625 26.825 22.225 22 22.55 28.449999999999996 27.200000000000003 21.8 23 21.65 29.875 26.3 22.175 24 20.45 30.025000000000002 26.375 23.150000000000002 25 21.75 28.549999999999997 26.950000000000003 22.75 26 21.7 29.175 27.3 21.825 27 21.15 29.375 26.724999999999998 22.75 28 21.224999999999998 29.75 27.675 21.349999999999998 29 22.8 29.175 26.85 21.175 30 21.65 28.15 27.150000000000002 23.05 31 19.875 28.599999999999998 28.675 22.85 32 23.200000000000003 27.975 26.5 22.325 33 21.05 27.025 28.299999999999997 23.625 34 21.45 29.349999999999998 27.474999999999998 21.725 35 22.6 28.4 27.525 21.475 36 20.525 29.7 29.15 20.625 37 21.7 28.7 26.424999999999997 23.175 38 21.5 28.199999999999996 26.474999999999998 23.825 39 19.900000000000002 28.225 29.475 22.400000000000002 40 22.0 29.299999999999997 27.875 20.825 41 22.25 29.125 27.975 20.65 42 22.1 28.075 27.325 22.5 43 22.475 27.200000000000003 28.375 21.95 44 22.675 28.625 26.3 22.400000000000002 45 20.875 28.275 28.425 22.425 46 21.975 28.675 27.150000000000002 22.2 47 21.525 27.675 28.725 22.075 48 21.7 29.875 26.900000000000002 21.525 49 22.0 28.475 26.900000000000002 22.625 50 22.475 28.275 27.650000000000002 21.6 51 21.375 27.700000000000003 28.15 22.775000000000002 52 21.325 28.449999999999996 27.900000000000002 22.325 53 21.725 28.199999999999996 27.900000000000002 22.175 54 21.45 27.700000000000003 28.875 21.975 55 22.025 26.974999999999998 28.349999999999998 22.650000000000002 56 21.375 27.975 27.425 23.225 57 22.05 29.099999999999998 27.224999999999998 21.625 58 21.825 28.249999999999996 27.975 21.95 59 21.325 28.249999999999996 28.975 21.45 60 21.925 28.175 27.3 22.6 61 20.9 28.849999999999998 27.175 23.075000000000003 62 21.95 28.925 28.625 20.5 63 22.475 28.325 28.575 20.625 64 21.475 28.249999999999996 27.925 22.35 65 22.725 28.349999999999998 27.900000000000002 21.025 66 21.825 28.225 29.049999999999997 20.9 67 22.5 27.150000000000002 28.275 22.075 68 23.25 27.150000000000002 28.050000000000004 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 1.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.5 21 3.0 22 5.0 23 4.5 24 5.5 25 7.0 26 11.0 27 17.5 28 20.0 29 32.0 30 47.0 31 50.0 32 59.5 33 79.5 34 90.0 35 117.0 36 172.5 37 201.0 38 211.0 39 246.5 40 285.5 41 299.0 42 323.0 43 364.0 44 381.0 45 379.0 46 344.5 47 312.0 48 302.0 49 265.0 50 238.0 51 201.0 52 149.0 53 134.0 54 114.0 55 83.5 56 73.0 57 60.0 58 35.5 59 24.0 60 22.5 61 19.0 62 17.0 63 11.0 64 6.0 65 6.0 66 5.0 67 4.0 68 1.5 69 0.0 70 1.5 71 2.0 72 1.0 73 0.5 74 1.5 75 3.0 76 2.0 77 1.0 78 1.0 79 0.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.15033826108744675 0.3 3 0.0 0.0 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.15 0.0 0.0 0.0 0.0 19 0.15 0.0 0.0 0.0 0.0 20 0.15 0.0 0.0 0.0 0.0 21 0.225 0.0 0.0 0.0 0.0 22 0.225 0.0 0.0 0.0 0.0 23 0.225 0.0 0.0 0.0 0.0 24 0.225 0.0 0.0 0.0 0.0 25 0.225 0.0 0.0 0.0 0.0 26 0.225 0.0 0.0 0.0 0.0 27 0.225 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.225 0.0 0.0 0.0 0.0 30 0.225 0.0 0.0 0.0 0.0 31 0.225 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.25 0.0 0.0 0.0 0.0 36 0.25 0.0 0.0 0.0 0.0 37 0.25 0.0 0.0 0.0 0.0 38 0.25 0.0 0.0 0.0 0.0 39 0.25 0.0 0.0 0.0 0.0 40 0.25 0.0 0.0 0.0 0.0 41 0.25 0.0 0.0 0.0 0.0 42 0.25 0.0 0.0 0.0 0.0 43 0.25 0.0 0.0 0.0 0.0 44 0.25 0.0 0.0 0.0 0.0 45 0.25 0.0 0.0 0.0 0.0 46 0.25 0.0 0.0 0.0 0.0 47 0.25 0.0 0.0 0.0 0.0 48 0.25 0.0 0.0 0.0 0.0 49 0.25 0.0 0.0 0.0 0.0 50 0.25 0.0 0.0 0.0 0.0 51 0.275 0.0 0.0 0.0 0.0 52 0.275 0.0 0.0 0.0 0.0 53 0.3 0.0 0.0 0.0 0.0 54 0.3 0.0 0.0 0.0 0.0 55 0.325 0.0 0.0 0.0 0.0 56 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328317 spots for SRR3207741.sra Written 328317 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra Read 328309 spots for SRR3207741.sra Written 328309 spots for SRR3207741.sra SRR ids: ['SRR3207741.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hvh7nvqp SRR3207741.sra spots: 6566188 blocks: [[1, 328309], [328310, 656618], [656619, 984927], [984928, 1313236], [1313237, 1641545], [1641546, 1969854], [1969855, 2298163], [2298164, 2626472], [2626473, 2954781], [2954782, 3283090], [3283091, 3611399], [3611400, 3939708], [3939709, 4268017], [4268018, 4596326], [4596327, 4924635], [4924636, 5252944], [5252945, 5581253], [5581254, 5909562], [5909563, 6237871], [6237872, 6566188]] SRR3207741 file size 1378732 SRR3207741 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207741 SRR3207741_1.fastq Input file: SRR3207741_1.fastq trimmed: SRR3207741-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:20:14 2025 >> started Mon Feb 10 18:20:17 2025 >> done (3.133s) 6566188 reads processed; of these: 11152 ( 0.17%) short reads filtered out after trimming by size control 27181 ( 0.41%) empty reads filtered out after trimming by size control 6527855 (99.42%) reads available; of these: 876126 (13.42%) trimmed reads available after processing 5651729 (86.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1691 0.03% 19 3128 0.05% 20 9381 0.14% 21 1862 0.03% 22 2464 0.04% 23 3812 0.06% 24 6535 0.10% 25 10879 0.17% 26 2916 0.04% 27 3503 0.05% 28 4922 0.08% 29 7637 0.12% 30 11231 0.17% 31 3360 0.05% 32 4325 0.07% 33 5030 0.08% 34 7646 0.12% 35 11841 0.18% 36 3761 0.06% 37 4860 0.07% 38 7366 0.11% 39 11552 0.18% 40 18735 0.29% 41 4847 0.07% 42 6595 0.10% 43 9724 0.15% 44 16106 0.25% 45 26349 0.40% 46 6931 0.11% 47 9120 0.14% 48 13887 0.21% 49 22200 0.34% 50 36539 0.56% 51 9418 0.14% 52 12010 0.18% 53 17902 0.27% 54 30005 0.46% 55 49882 0.76% 56 12119 0.19% 57 16583 0.25% 58 25107 0.38% 59 42179 0.65% 60 71795 1.10% 61 16573 0.25% 62 22420 0.34% 63 33351 0.51% 64 54578 0.84% 65 89990 1.38% 66 22830 0.35% 67 48649 0.75% 68 5651729 86.58% 6527855 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=7.36 fanout-score-rank=13 prefix-density=0.08 prefix-fanout=3.7 sequence=GCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=112.10 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=16.3 sequence=CTTCTTCTTCCTTTGG Started job on | Feb 10 18:20:37 Started mapping on | Feb 10 18:20:37 Finished on | Feb 10 18:20:44 Mapping speed, Million of reads per hour | 3357.18 Number of input reads | 6527855 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6167713 Uniquely mapped reads % | 94.48% Average mapped length | 66.12 Number of splices: Total | 1172039 Number of splices: Annotated (sjdb) | 1154133 Number of splices: GT/AG | 1155516 Number of splices: GC/AG | 13920 Number of splices: AT/AC | 1156 Number of splices: Non-canonical | 1447 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217462 % of reads mapped to multiple loci | 3.33% Number of reads mapped to too many loci | 106849 % of reads mapped to too many loci | 1.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 142680 142680 142680 N_multimapping 217462 217462 217462 N_noFeature 261755 3184233 3203571 N_ambiguous 59748 8976 9171 UnstrandedReadsAssigned:5846210 PositiveStrandReadsAssigned:2974504 NegativeStrandReadsAssigned:2954971 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207741 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207741-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,527,855 reads, 6,027,856 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR3207741.ke.tsv 34699 SRR3207741.se.tsv 87100 total ==> SRR3207741.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 152 19.4588 Potri.005G024800.1.v4.1 1035 936 18 4.72437 Potri.004G059700.1.v4.1 961 862 11 3.13497 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 96.7414 8.35661 Potri.016G087400.1.v4.1 270 171 205 294.513 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12.7927 1.87739 Potri.012G127500.1.v4.1 977 878 615 172.079 ==> SRR3207741.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 548 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 93 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207741 completed mapping pipeline successfully